Detail of EST/Unigene TCSL79421
Acc. TCSL79421
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Tubulin-specific chaperone A OS=Arabidopsis thaliana E-value=3e-46; Tubulin-specific chaperone A OS=Homo sapiens E-value=3e-16; Tubulin-specific chaperone A OS=Gallus gallus E-value=3e-16; Tubulin-specific chaperone A OS=Rattus norvegicus E-value=5e-16; Tubulin-specific chaperone A OS=Oryctolagus cuniculus E-value=1e-15;
Length 780 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435 (9 ESTs); SRR015436 (8 ESTs); SL_maturing_fruit (4 ESTs); SL_Lyc_leaf (2 ESTs); SL_MicroLEAF3 (2 ESTs); SL_CELL_BTI (2 ESTs); SL_flower_buds4 (1 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); LIBEST_024457 (1 ESTs);
Sequence TTTTTTCNTTTTTTTTTTTAATACAAAAAGAAACCAACTTTCTTTATATATTTTCATTTA
ATAGAGTCACATAATTGAAAGTAAACAAACTTAAGACGATCACAAAACATAGTTCAATGT
TGATTTTGTAGCCTTGGTTTAGTGATAAACACATGACATTTGATATATGAACCTCTATCC
GAGCGAGTTTTATATAACACAAGAATGTACCCAAACGATTGCATGACAGAAACTCATCAG
GCAGCACGAAGAGTTCTCTAGTTATAACAGTAGTGTAACAGAGTCCAATGGACAAGACAA
AGTGCTTTAAACTTCAGAAGATTCAAACAACTTCTCAACATCTGCTATTATGTTTCGAGC
TTCTTCAAATTCAGGGCCTTGTTTTTCTTCCGTCTCCTCTAACTCAACCAAAGTTCCTTT
AAGGTCCTCTAGTGCTCCTTCCAGGCGTTTGCGACAATCAGGGACCATCATTCTGGATTC
AGCCAACACATTTTCCTGCTGTTTGAGGTCATAGGGATCGGCACCTTTCTCCTTCATATC
AGCAGTCTTAGCAGCTTCTCTCTCAACCTCTTTCTCATAGGAATGGAGCTCCTTCAGTAT
GCGTTTGCAAGTAGATGTCTTGATTTTCAGATTTCTGACGGTAGCCATTGCCAATGCTCA
ACGAAATCCGGAGGGCGATGGTCGCCGTGCTAGTGTACTGCCGGTGGTGGTGCCTGAGCT
AATTCTCGAAATGTGTGTAGCCTTTACAAGAAAAAACTACTATAGAAGCTTTAATTTTTA
EST members of Unigene BP890498  DB687712  SRR015436.74889  SRR015435.86287  SRR015436.319885  BP904266  DB681893  SRR015436.114464  GO374103  SRR015436.222527  SRR015435.351531  SRR015435.172406  SRR015435.154167  BG734955  SRR015436.272115  SRR015436.247869  BP902723  AW093249  BW692811  BP895041  AW094598  SRR015436.89473  BG125510  SRR015435.112762  SRR015435.105608  SRR015436.154738  BI929060  SRR015435.291129  BP895390  SRR015435.180488  BP892111  SRR015435.246756 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817592 
Trichome-related Gene from Literature 817592