Detail of EST/Unigene TCSL78996
Acc. TCSL78996
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=9e-69; Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=1e-68; Glutathione synthetase OS=Xenopus laevis E-value=3e-22; Glutathione synthetase OS=Rattus norvegicus E-value=6e-20;
Length 807 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_MicroFRUIT (3 ESTs); LIBEST_024426 (3 ESTs); SL_flowerbuds4 (2 ESTs); SL_maturing_fruit (2 ESTs); SL_GFRUIT (1 ESTs); SL_flower_buds3 (1 ESTs); SL_MicroLEAF3 (1 ESTs); SL_CROWNGALL (1 ESTs); SL_breaker_fruit (1 ESTs);
Sequence GCCTTTAGCAATTAGCAGCCAGCCAAACGTAAAGAGCCACTTTGGACGATAATAAGGTAG
TAACATAAAAGATTGGTCCAAAGAATGTCAAAATGGGCAGCGGCTGTTCTTCTCCATCAA
TCTCACTAACTACCATCGCTACCTCTCATTTTCAATCCCAAGAATCACTATCAAACTCTT
TAAATTTCTACTCACCTACTAGATTTTTGGAACCCCATCTCCTTAAATCTTCCAAGATTT
TCATACCCAAATCCCCATTGAAGTGTGCTAAAGTGCCCGAAATGCAGACCCAACTGGAAG
ATTCTGCGAAACCCATTGTCGATCCTCATGATATCGACTCAAAATTGGTGCAGAAGCTTG
CTAATGATGCACTTGTCTGGTGCTCTCTTCGTGGACTTCTTGTTGGTGACAGAAATTCGG
AGAGGTCAGGAACTATTCCTGGTGTTGATATGGTTCATGCTCCAGTTGCTCTCATACCAA
TGTCATTTCCTGAAAGTCATTGGAAGCAAGCTTGTGAAGTTGCTCCTATTTTCAATGAAC
TCGTGGATCGCGTGAGTCAGGATGGAGAATTTCTGCAGCAATCACTGTCTAGGACGAGAA
AAGCTGATCCTTTCACCTCCAGATTACTAGAAATCCACTCCAAGATGTTAGAAATCAACA
AGCTAGAGGAAATACGCTTGGGGTTGCATCGCTCAGACTATATGCTGGATGAGCAAACGA
AATTACTTTTGCAAATAGAGCTTAACACAATCTCATCATCATTTCCAGGGCTAAGTTGTC
TGGTCAGCGAGCTTCACAGGAGCTTGC
EST members of Unigene FS201188  BM535833  BP882910  BI926660  BE459119  BP882900  DB692496  FS181557  DB717551  FS201637  DB714467  AW615910  BG133999  DB715451  BE462971 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K01920 glutathione synthase
EC 6.3.2.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 832797 
Trichome-related Gene from Literature 832797