Detail of EST/Unigene TCSL78118
Acc. TCSL78118
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) RNA polymerase II C-terminal domain phosphatase-like 3 OS=Arabidopsis thaliana E-value=0; RNA polymerase II C-terminal domain phosphatase-like 4 OS=Arabidopsis thaliana E-value=2e-61; RNA polymerase II subunit A C-terminal domain phosphatase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-15; RNA polymerase II subunit A C-terminal domain phosphatase OS=Mus musculus E-value=5e-15; RNA polymerase II subunit A C-terminal domain phosphatase OS=Homo sapiens E-value=3e-14;
Length 878 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435 (5 ESTs); SL_GFRUIT (3 ESTs); LIBEST_024457 (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_FRUIT (1 ESTs); SL_SUS_LEAF (1 ESTs);
Sequence GGAATGTGGACCAAGTTACGGCCTGGGATCTGGAATTTCTTGGAAAAGGCGAGCAATCTT
TTTGAGCTGCATCTCTATACCATGGGTAACAAGCTATATGCCACGGAGATGGCCAAATTG
CTAGATCCAAAAGGTGATCTGTTTGCTGGACGAGTGATCTCCAGGGGTGACGATGGAGAT
CCATTTGATGGGGATGAAAGGGTTCCCAAGAGTAAGGACTTGGAGGGGGTTTTGGGCATG
GAGTCGGCTGTTGTTATTATAGATGATTCTGTGAGAGTCTGGCCACATAACAAGCTAAAT
TTGATTGTTGTAGAGAGGTATATTTACTTTCCTTGCAGTAGACGGCAATTTGGTCTTCCT
GGTCCTTCTCTTCTTGAGATTGATCATGATGAAAGACCTGAAGATGGCACATTGGCCTCT
TGTTTGGGGGTTATTCAAAGAATACATCAGAATTTTTTCACACATCGGTCCATAGATGAA
GCTGATGTTAGGAACATCTTAGCGACAGAACAAAAAAAGATTCTGGCAGGTTGCCGTATT
GTCTTCAGCAGAGTGTTTCCTGTTGGTGAAGCCAGTCCCCATTTGCATCCTCTGTGGCAG
ACTGCTGAACAGTTTGGTGCTGTCTGCACTAGTCAAATTGATGATCAGGTTACCCATGTG
GTTGCAAATTCTCTTGGGACGGATAAGGTTAATTGGGCACTTTCCACCGGACGATCTGTT
GTCCATCCTGGCTGGGTGGAGGCATCAGCTTTACTTTATCGGAGGGCAAATGAGCATGAT
TTTGCTATTAAATCTTAAATTAACACAATCTCCGTGTCTTGGTTAAAAGAAAACTGAAAA
AGGGGATGAAATGAAGAAACGGAAACAGTAGGTAAACA
EST members of Unigene SRR015435.51639  BP901473  BF050849  GO374596  SRR015435.256776  SRR015435.134904  BF051717  BE458475  BE435393  SRR015435.229485  SRR015435.75563  AI778466 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.1.3.16 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817919 
Trichome-related Gene from Literature 817919