Detail of EST/Unigene TCSL76033
Acc. TCSL76033
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 11 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 17 OS=Arabidopsis thaliana E-value=0;
Length 1176 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436 (11 ESTs); SRR015435 (11 ESTs); SL_MicroLEAF3 (2 ESTs); SL_flower_anthesis (2 ESTs); SL_SUS_LEAF (1 ESTs); SL_flowerbuds4 (1 ESTs);
Sequence CAATTACGTCTCAATCCCAATAATGGCTCGAGAAGAACATCTTCTATCAACGGAGATTGT
GAACCGAGGGATATCGGATGAGGGATCACAAACGTTCTCCGTTAGGGTACGGAGGCGTTT
GCCGGATTTCTTGCAATCGGTTAACTTAAAATATGTGAAGTTAGGGTACCATTACTTGAT
AAAACATGGGATATATTTGGCTATATTGCCAGTGTTGGTGTTGGTTTTCAGTGCTGAAAT
TGGGAGTCTAAGTAGAGAGGAGCTGTGGAGGAGAGTTTGGGATAGCACAACACGTTATGA
TTTGGCTACAGTGTTGTCATTTGTGGCACTTTTTGTCTTCACTATCTCTCTTTATATCAT
GTCTAAGCCAAAACCTATTTACCTTCTTGATTTTGCATGTTACAAGCCAAGTGATGATCT
TAAGGTAACAAAGGAGCAATTCATCGAGTTAGCACGAAATTCGGGCAAATTCGATGAATC
TAGTCTGGAATTTAAAAAGAGAATTCTAGAATGTTCTGGAATAGGGGACGAGAGTTACGT
CCCGAGATCCATTGGATCGTCAGAAAACACAGCTACGATGAAAGAAGGACGATACGAGGC
ATCAACGGTGATGTTCGGAGCTCTGGATGAACTGTTCGAGAAGGCGAAAATTCGGCCTAA
GGACGTCGGAGTATTGGTGGTGAATTGCAGTATTTTCAACCCAACACCATCACTTTCAGC
CATGATCATAAATCACTATAAAATGAGGGGAAATATACTTAGTTTCAATTTAGGTGGAAT
GGGTTGTAGCGCTGGGATAATGGCATTAGATTTGGCACGTGACATGTTACAAGCTAACCC
TAATAATTATGCCATCGTAGTTAGTGGTGAGATGGTTGGATATAATTGGTACCCTGGCAA
ACAGCGATCGATGCTTATTCCAAATTGCTTTTTTCGAATGGGTTGCTCCGCCCTCCTCCT
CTCCAATCGTCGTCGCGATTACCACCGTGCTAAGTACAGCCTCGAACATATCGTCAGGAC
ACATAAAGCTTCCAATGATCGCGCATTCAGGTGCATTTATCAAGAAGAAGATAGCGAGCA
TTACAAGGGGCTAAAGATAAGCAAAGATTTAGTAGAAGTTGGAGGAGATGCATTGAAGAC
TAATATTACTACATTAGGCCCTTTGGTTCTACCTTT
EST members of Unigene SRR015435.309223  SRR015435.320655  SRR015435.98696  SRR015435.135494  DB686101  SRR015435.355389  BI934336  SRR015436.207882  SRR015435.136513  SRR015436.215020  DB695070  SRR015436.310410  SRR015436.204163  SRR015436.272880  AW934652  SRR015435.80388  SRR015435.244010  SRR015435.212962  SRR015436.91635  SRR015436.280102  SRR015436.269161  SRR015435.57176  SRR015436.275196  AI780638  SRR015435.204844  BI933818  SRR015436.278448  SRR015436.218668 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817165 
Trichome-related Gene from Literature 817165