Detail of EST/Unigene TCSL75742
Acc. TCSL75742
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Cysteine synthase OS=Spinacia oleracea E-value=0; Cysteine synthase OS=Citrullus lanatus E-value=0; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=0; Cysteine synthase OS=Solanum tuberosum E-value=0; Cysteine synthase OS=Zea mays E-value=0;
Length 1231 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_MicroLEAF3 (7 ESTs); LIBEST_024426 (3 ESTs); SL_ROOT (2 ESTs); SL_SUS_LEAF (2 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_SHOOT_4WEEK (1 ESTs); SRR015435 (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_FLOWERBUDS (1 ESTs);
Sequence AAAGTAATTTCTTTTTACATTGATTCGACAAATATTATTCCACAATATCAAAATTTTGGA
TGATATTTCGCAATATTTTATATTATCAATGGAGCAAGATTCAAAAAGTGTTCTCTTCTA
AGTTTGCATTATAAAGTCAAAATATATAAACAAATTGAAAGAGAAATATAAATACCCACC
AATCTTATTAGTTTTTTTTTTTTCATGTGAGTTTTTGGTGAATCCCTGGATAAGGAAGGT
AGCAACTTGTGAAAGTATCCCCCAGAGTTAGTCATTAAGGAGATATGGAAGAGAAGGATG
ATATAGCGAAGGATGTCACAGAACTTATTGGGAACACCCCTATGGTATATCTCAACAAAA
TTGTCGAAGGTTGTGCTGCTCAAATCGCAGCCAAATTGGAGACAATGGAACCATGCGCGA
GTGTCAAAGACAGGATTGCATATAGTATGATCAAAGATGCCGAAGATAAGGGCCTGATTA
CCCCTGGCAAGTCTGTCCTCCTTGAGGTAACCAGTGGTAATACTGGCATTGGTCTGGCAT
TTGTAGCTGCAGCTCGTGGCTACAAACTCGTGATAGTGATGCCATCATCGTATAGTCTTG
AGAGAAGGATTGTTCTTAAAGCTTTGGGGGCTGAGTTATACATAACAGATCCAGCCAAAG
GTTTAGATGGATTGCTTCAGAAGGCACAAGAGATTCTAGATAGGACGCCAAACAGTCATT
TTTTTCGTCAGTTTGAGAATCCTGCCAATCCAAAGATTCACTATGAAACAACTGGACCAG
AAATATGGAAGAGCACAGGAGGAAAAGTTGATATTTTCATTGCAGGGATTGGGACTGGAG
GCACGGTGACGGGAGCAGGAAGGTTCCTTAAGGAGAAGAATCCAGAAATAAAGGTATATG
GTGTAGAACCAGCTGAAAATGCGATTCTAAACGGAGGACAACTAGGGCCACATAAAATCC
AAGGAATTGGTGCTAGTTTCATCCCAGCCGTCCTCGATCAAAGCATCCTGGATGGAGTTC
TTCAAGTATCTAGTAATGAAGCTATTGAAATGACAAAGGTTCTTGCATTGAAAGAAGGCC
TACTGGTAGGAATATCATCAGGTGCTGCAGCTGCTGCAGCAGTACAAGTAGCAAAAAAGC
CCGAAAATGCTGGGAAACTTATCGCGGTCATCTTCCCTAGTTTCGGGGAGCGTTATCTTT
CCACTGTGCTGTTTGATTCTATTAGAGAAGA
EST members of Unigene AI779941  DB687810  FS191282  FS204605  DB704590  BP896452  DB682080  SRR015435.225166  DB697969  DB698982  DB694786  FS202259  AW621785  AI781960  AW738609  AW032102  BE354800  AW621954  DB695376  BG126251  AW030118 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase;
Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase;
Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase;
Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase;
Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase;
Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase
EC 2.5.1.47  4.2.1.22 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 818978 
Trichome-related Gene from Literature 818978