Detail of EST/Unigene TCSL73758
Acc. TCSL73758
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=0;
Length 2380 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436 (43 ESTs); SL_Lyc_leaf (31 ESTs); SRR015435 (26 ESTs); SL_CELL_BTI (4 ESTs); SL_MicroLEAF3 (3 ESTs); SL_flower_anthesis (2 ESTs); SL_maturing_fruit (2 ESTs); SL_FLOWERBUDS (2 ESTs); LIBEST_024458 (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_DEF_ROOT (1 ESTs); SL_FRUIT (1 ESTs); SL_breaker_fruit (1 ESTs); SL_flowerbuds4 (1 ESTs); SL_ROOT (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_TRI (1 ESTs); LIBEST_024426 (1 ESTs); SL_RES (1 ESTs);
Sequence CATCTTCTTCCTTTCTGTTACGGAGTTATCTTTCCTCTGTCAACTTTATCAGGTTCTTGC
TTCTTTTCTGAGCGTATCAACATGGCGACTTCATCAGTATGCATAGCAGGAAATGATTTG
TCCACCCATAGAACACAGAAAGTTTTTAGGAAGGAGATCTATGGCAGAAAAATTTTGTAC
TCCTCAAATCTTCCATCATCTAGGAAAACATCAAGAGTAGTTGTAAAAGCATCCCTTCAG
CAAGGGCCACATGAAGGAAGAAGAGGCTTTCTTAAATTATTGCTTGGAAATGTTGGGCTT
GGAGTGCCTGCTTTGTTAGGTAATGGGAAAGCCTATGCTGATGAGCAAGGTGTTTCTAAC
TCAAGGATGTCTTATTCTAGATTTTTGGAGTATCTGGACAAGGACAGGGTGCAAAAAGTA
GATCTGTTTGAAAATGGAACCATAGCTATTGTAGAAGCTGTATCTCCAGAATTGGGGAAC
CGAGTGCAAAGAGTTAGGGTACAACTACCTGGACTCAGCCAGGAACTCCTTCAAAAGTTC
CGGGAAAAGAACATTGATTTCGCTGCTCACAATGCTCAAGAGGACTCAGGTTCTCTCATA
TTCAACTTGATTGGAAATCTGGCTTTCCCACTTATTTTGATTGGTGGTCTTTTCCTGCTA
TCAAGGCGGTCTAACGGAGGAATGGGAGGTCCTGGTGGGCCTGGAAACCCACTAGCATTT
GGTCAATCAAAGGCTAAGTTCCAAATGGAGCCAAACACTGGTGTGACATTTGATGATGTT
GCTGGTGTAGATGAAGCAAAACAAGATTTTATGGAGGTCGTAGAATTTTTGAAGAAACCT
GAGAGATTTACTGCAGTAGGGGCTCGTATTCCAAAAGGTGTTCTTCTTGTTGGTCCTCCT
GGTACTGGGAAAACCTTGCTAGCAAAGGCAATTGCTGGTGAAGCGGGTGTTCCATTTTTC
TCAATTTCAGGTTCAGAATTCGTTGAGATGTTTGTTGGTGTTGGAGCCTCTCGAGTCCGT
GATCTTTTCAAGAAGGCCAAGGAAAATGCTCCTTGCATTGTATTTGTTGATGAAATTGAT
GCTGTTGGGCGGCAAAGAGGGACTGGAATTGGAGGAGGAAATGATGAAAGGGAACAGACC
CTGAACCAACTATTGACTGAAATGGATGGTTTCGAAGGAAATACTGGTATAATAGTTGTT
GCGGCAACCAATCGTGCAGATATTCTTGACTCTGCTTTGCTGAGGCCAGGACGATTTGAT
AGACAAGTATCCGTGGATGTCCCAGACATCAAGGGAAGAACAGAGATCTTAAAGGTTCAT
GCCGGCAACAAGAAGTTTGATTCAGATGTGTCTCTTGAAGTTATTGCCATGAGGACACCG
GGTTTCAGTGGAGCAGATCTTGCTAACCTCTTAAATGAAGCAGCCATTCTTGCAGGTCGA
CGTGGTAAGACAGCAATCGCATCCAAAGAGATTGATGATTCAATTGATAGGATAGTGGCT
GGTATGGAAGGAACAGTCATGACTGATGGCAAGAGCAAGAGTCTGGTGGCATATCACGAA
GTTGGACATGCCATCTGTGGAACTCTCACTCCAGGGCATGATGCTGTACAAAAGGTCACT
CTAATCCCACGTGGTCAGGCAAAAGGTTTGACCTGGTTCATTCCTGCAGATGACCCAACC
TTAATATCCAAGCAACAACTCTTTGCTAGAATTGTTGGTGGACTTGGTGGAAGAGCTGCA
GAAGAAGTGATCTTTGGTGAACCTGAAGTGACCACTGGTGCTGCTGGTGATTTGCAGCAG
ATCACTGGTTTGGCAAAACAGATGGTTGTCACTTTTGGTATGTCTGAACTTGGCCCGTGG
TCCCTCATGGATTCTTCAGCCCAAAGTGGTGATGTAATCATGAGAATGATGGCCAGGAAC
TCGATGTCAGAAAAGCTAGCTGAAGACATTGATGTTGCTGTGAAGAAGCTTTCAGACAGT
GCATATGAGATTGCATTGAGCCAAATCCGCAGCAACCGTGAAGCAATTGATAAGATTGTG
GAAGTCCTCCTTGAAAAGGAGACGATGACTGGAGATGAATTCCGTGCTATTCTCTCAGAA
TTTGTTGAAATTCCTGCTGAAAACCGCGTCCCTGCTGCTGTTCCTACCCCAGCAGCTGTA
TAATAGCTTGAACATATACTGCAACTTGTACAATTCACATACACTTATCCCCCTAATTTG
ATCTAGAGTATAAACAATATATAGACTATAAGAAAGTTAAAAAACACTTTTGTGCATTTG
TGTATGAAGCAAATTTTCACATTTGATATAGAACTAGTCTTTTCTTCACTAAAAAAAAAA
AGAAAAAAAAACAAAACATGTCCGGCCGCCTCGGTCTCTA
EST members of Unigene AW040697  SRR015436.96091  SRR015436.140110  SRR015436.227141  SRR015435.238512  SRR015435.197718  BP896835  SRR015435.95650  BG130407  BP906878  BP908808  BP909772  SRR015436.229157  AW217355  BI933759  SRR015436.127506  SRR015436.45779  SRR015435.228001  AW737540  SRR015435.74682  SRR015436.206521  SRR015435.46764  SRR015436.267295  SRR015436.63654  SRR015436.123732  SRR015435.309617  SRR015436.97792  BP907481  SRR015436.277856  AW092922  SRR015436.250984  BP910734  BP910926  SRR015436.65064  AI773209  AW219238  SRR015435.40807  SRR015436.272541  BI933515  DB682448  AW092275  BP880380  BP906452  BP896985  SRR015435.289337  BP907997  SRR015435.214673  SRR015436.82853  SRR015436.118741  SRR015435.337569  BP910149  SRR015435.187824  BP900874  AW035651  SRR015436.289315  FS195106  SRR015436.90911  SRR015435.224184  BP909755  SRR015435.212136  SRR015436.90916  BP897001  SRR015436.168037  SRR015436.75903  BE461585  BP902367  SRR015435.88558  SRR015436.73959  AW737612  BM535761  BP909115  SRR015435.22008  GO376085  BP910080  BP907374  AW934098  SRR015436.298063  SRR015436.152688  SRR015436.294874  BP908943  BP908182  SRR015436.52952  BG628806  SRR015436.253955  BP906822  SRR015436.135467  SRR015435.80402  BP908173  SRR015436.72608  SRR015436.124047  SRR015436.159560  SRR015436.298456  SRR015436.25669  SRR015435.32124  BF098202  BP894372  SRR015436.134305  BP904826  SRR015436.159429  SRR015436.150094  SRR015436.264240  SRR015436.252271  BP898440  AW092766  SRR015435.355543  DB707209  SRR015435.97537  SRR015436.79726  SRR015436.127887  ES893661  SRR015435.121914  SRR015435.244258  SRR015436.283498  SRR015435.245989  SRR015436.249201  SRR015435.250059  DB691349  BP906389  BP908321  BP910059  BP908312  BP905803  BP904452  BP910636  SRR015435.56028  SRR015435.278941 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.-  3.6.1.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817646 
Trichome-related Gene from Literature 817646