Detail of EST/Unigene TCNT64113
Acc. TCNT64113
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Tubulin-specific chaperone A OS=Arabidopsis thaliana E-value=3e-45; Tubulin-specific chaperone A OS=Homo sapiens E-value=9e-16; Tubulin-specific chaperone A OS=Rattus norvegicus E-value=1e-15; Tubulin-specific chaperone A OS=Mus musculus E-value=2e-15; Tubulin-specific chaperone A OS=Oryctolagus cuniculus E-value=3e-15;
Length 676 nt
Species Nicotiana tabacum
Belonged EST Libraries LIBEST_024954 (3 ESTs); LIBEST_026761 (3 ESTs); LIBEST_026762 (2 ESTs); LIBEST_026714 (1 ESTs); NT_DL (1 ESTs); NT_TL13 (1 ESTs); NT_KN6B (1 ESTs); NT_MAT005 (1 ESTs); NT_AGN_PNL (1 ESTs);
Sequence CCTACAGATTTTACTGCTTTCAGTCGAAAGCTTTGACAATGGCTACCGTGAGAAATCTGA
AAATCAAGACATCAACTTGCAAGCGCATACTGAAGGAGCTTCATTCCTATGAGGAAGAGG
TGGAGAGAGAAACTGCCAAGACTGCTGATATGAAGGACAAAGGCGCCGATCCCTATGACC
TCAAACAGCAGGAAAATGTGCTGGCTGAATCCAGAATGATGGTTCCTGATTGTCGCAAGC
GCCTGGAAGCAGCGTTGGATGACCTTAAAGGAGCTCTGGTTGAGTTAGAGGAGACGGACC
AAAAAGACGGCCCCGAATTTGAAGAAGCTCAAACCATAATAGCAGATGTTGAGAAGTTGT
TTGAATCTTCGGAAGTTTAACTTACAGTCGTCTTGTCCATTAGACTTTGTTACACTACAT
TTCTAACTAGAGAACTCTTCCTGCTGCCTGATGAGCTATTGTCGTGCAATCGTGTGGTAC
GTTCTTGTGTTATAAAACTCGACGTGATGGAGCTCATTTATCAAATTATCATGTGTTTAT
CACTAAACCATGACGCCAAAATCAATATTGAACTTTGAGTTTTATGATGTATTATGTTTA
TTTCTTTGATATCATGTGAATCTTTTGTGCGTAAGGGCGTGGCCATCAATGAAATGAGCT
CGTCTTCTTTCTTGGT
EST members of Unigene HS081871  FS401467  BP533770  HS084871  HO845213  EB433285  FS383056  HS085528  AM793292  FS432127  EB442162  FG184738  HS081894  HS081496 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817592 
Trichome-related Gene from Literature 817592