Detail of EST/Unigene TCNT63689
Acc. TCNT63689
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=3e-50; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=1e-45; 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=2e-45; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=1e-43; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=1e-42;
Length 713 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_DL (2 ESTs); NT_COL (2 ESTs); LIBEST_023330 (1 ESTs); NT_AGN_PNL (1 ESTs);
Sequence ATCGATCAGCAATGTATAATGTCATAATACATTTATTACACAAATTGTCGACAATAGCAA
AGATATGCTCTCTATATTTGCATGACCATTACTTATATATAATGATGTAAAGATCAATTC
TTGAAGATTAAGGTGAACATCATATCTAAAGGCCAAGGCCAAGATTATATTGGAAAGAAG
CTATATATGTTTGTTAATCCTTTCCACAAAATCAACTTAATATAATAACGTAACCAATAT
TCTTGACTATACATTTATATAGTCATTCATCCATCTTGTAACTCCAAATCTTTCATGAAA
ACTCACACTTATTGTGTGAGAGACTGAGGGTACATATCAACGCAATCAATCCAAGGATTT
GTTGAAGGCTTTTTAACACGGCGAATGGCTTTCCAAACAGCACTGTTACACTTAAAACCT
GAACCAAAAGCAATTTGCCACACACGGTCGCCTCTTGCAATTTTCTCCTTTGCCTCCAAA
TAAGCCAACTCGTACCAAATGCTGCTACTAGACGTGTTACCAAATCGGTGCAGTGTGGCC
AGAGAAGCTTCCATATTATTCTCACTCAGTTGTAAGTTCCTTTGAAGCTCATCAAGGACA
GTTTTGCTGGCTGCATAGACACAGAAATGCTCGAAAGCGAGTTTGTAGTCTGGAATATAA
GGCTTATTGGCCAGTTGGGAATTGGAATTGCCTTTGGCATTATTATTTTTATT
EST members of Unigene AM800444  FG623481  AM790066  AM820038  AM788587  FG192468 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817165 
Trichome-related Gene from Literature 817165