Detail of EST/Unigene TCNT60467
Acc. TCNT60467
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 996 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_SL (4 ESTs); NT_MAT001 (1 ESTs); LIBEST_024954 (1 ESTs); LIBEST_026761 (1 ESTs);
Sequence CAAGAATCCTAACATAAACCCAGTAGATTTTCAAGAGTTGAAGATTTAGTAAGAATGGCG
GAGGGCAGAGACAGATTAACTAGGCTGGAAGATCCAATATACGTCTACAGTCGTCGACGG
AGGTCAATTGGCAGAGGCGGCATTGAGATCTTTCAGGATGAATCAGAAGCGAGCACTGCC
GTAGTTCCCCTACGGACTACGCCGACGACGGTAAGAACGTCCGGCGGTGGTCGTGGGCGA
AATTTGCGTGGAACTCCGGTCAGGGCGATTGGTAGTCAGAACATTTCGCCGGGAGGCCGG
GGACGATGGCGCGGGCGTCGCAGTGTACTTCCTTCTTGGTATCCAAGAACTCCTCTCCGT
GACATCACTTCTATTGTCAGGGCTATTGAAAGAACAAGAGCCCGCTTGAGAGAAAGTGAA
GGCGAACAACTTGAGAGACTTCTACCCCAGGACCATACTGATCTTGATCCTTCTGAATCT
ACATCAGGTGCTCAACTTGAGCACAAGGATTCTATGATTACTCCACGTCCAAAAGTCAGA
AGCAGGTATCATCCCAAATCTGTTGGTAAGGTGCCAAAGATATTGCTTGATATCACCAAT
CAAAAAAGTTCTGAAGACACTGATTGCCTCACACCACAAAGAAAGTTGCTGAACTCAATT
GACACTGCTGAGAAAGCTGTGATGGACGAACTGCATAAAATGAAGAGGGCCCCTAGTGCT
AGAAAAGAAGAGAGGAAAAAAAGAGTGAAAACTTTAATGTCCATGCGCTGATTTTTCATC
TGATGTCCAACTCAATCAAGGTTGAGGCAAACAGGCTTTGAAATTTTGGAGGAAAGGAGA
AATTGCAGCTGACCGGCCAGGTAAAGACGATCATCTTCTGATGATCAAGCTATTAGTTGA
ATCAGGATATCGCTGATATCTTTCTGATCCTTATTAGTAACTGGAGTTAAAACTGTACCT
TGTGGAATTGATTTTCACGCATTGAAGTTTATGATT
EST members of Unigene AM781964  HS081808  AM792664  FS394361  AM797541  AM823244  BP529221 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 818827 
Trichome-related Gene from Literature 818827