Detail of EST/Unigene TCNT59335
Acc. TCNT59335
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=0; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; Mannitol dehydrogenase OS=Apium graveolens E-value=0;
Length 1238 nt
Species Nicotiana tabacum
Belonged EST Libraries LIBEST_023330 (3 ESTs); LIBEST_024954 (2 ESTs); NT_AGN_PNL (2 ESTs); NT_TRI (1 ESTs); NT_KL4B (1 ESTs); NT_KP1BS (1 ESTs); NT_COL (1 ESTs);
Sequence AGTCTCATTTTCTAGGCATTCTTAGTTATAGCTAGCTATATTTTTTGGTTATATTTTTTA
ATTAGGTGAAATGGCAAAAAACCCAGAAGAAGAGCATTCAGTGAAGGCTTTTGGATTTGC
AGCTAGAGACACTTCTGGGGTTCTTTCTCCTTTCAACTTTTCAAGAAGGGCTACTGGGGA
GAAAGATGTGCAATTCAAAGTCTTGTATTGTGGAATTTGCCATACAGATCTTCACTTTAT
CAAGAATGAATGGGGAGTCACTAGATATCCTGTTGTACCTGGGCATGAGATTGTGGGTGT
GGTGACTGAAGTCGGTACAAAAGTTGAGAATTTTAAAGTTGGAGACAAAGTAGGAGTTGG
ATACATGGTAGGATCATGTCGTAAATGTGCAAGCTGTGACAATGATATGGAGAATTACTG
TCCTGGTCAGATACCGACTGCTAATGGTACTAACTCCGATGGAACAGTAACGTATGGAGG
TTACTCCGATATCATGGTTTCTGATGAACATTTTGTAGTTCATTGGCCTGAGAATTTGCC
AATGGAAGCAGCTCCTTTACTGTGTGCTGGGATCACAACTTATAGTCCAATGAAATATTT
TGGACTAGATAAGCCTGGAATGCATATTGGTGTTGTTGGTCTTGGTGGTCTTGGTCATAT
GGCTGTGAAATTTGCTAAGGCTTTTGGAGCTAAAGTCACAGTTATTAGTACCTCTATTGG
TAAAAAAGATGAAGCTCTTCAACATCTTGGTGCTGATTTGTTTGTACTTAGCAGCCAGCC
TCAGGAGATTCAGGGTGCATTGAACACAATGGATGGCATTATCGATACAGTTTCAGCAGA
TCATCCACTTTTGCCATTGCTTGGTATGTTAAAGCCTAATGGGAAGCTTGTTATGGTTGG
TGCATATGCAAAACCACTTCAACTGCCAGTTTTTCCCTTGCTTTTGGGAAGGAAGCTAGT
GGCTGGGAGTGCTATAGGAGGAATAAAAGAAACTCAGGAAATGTTAGATTTTGCGTCAAA
GCATAATATAACACCAGATGTTGAAGTCGTGCCAATGGACTATGTGAACACTGCTGTCGA
TCGCCTACTGAAGTCTGATGTGAAGTATCGATTCGTGCTCGATATTGGCAACCATTCAAA
CTCTACTTAAGCTTAAATCATTTTTTGGTTCTTGAAAATCACTGTTGATTTTCTCAGCTC
GTGTGTTAAACAAGTCTTAATAATAGCATTGTCTTTGC
EST members of Unigene FS432416  DV162725  FG622892  FG628447  FG194039  FG625659  EB681063  FG194129  FG640294  AM801592  FS381474 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase;
Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase;
Metabolism > Metabolism of Cofactors and Vitamins > ko00830
EC 1.1.1.1 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 829954 
Trichome-related Gene from Literature 829954