Detail of EST/Unigene TCNT59099
Acc. TCNT59099
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=0; Mannitol dehydrogenase OS=Apium graveolens E-value=0;
Length 1299 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_AGN_PNL (5 ESTs); LIBEST_024954 (3 ESTs); NT_KL4B (2 ESTs); NT_KR3B (1 ESTs); NT_EST_CSP (1 ESTs); LIBEST_023330 (1 ESTs); NT_CHO_SL (1 ESTs); NT_KT7 (1 ESTs);
Sequence ACACTTTACTTCACCATTTTCCATAGTTCCACTACCAATAATAACATTGTCTGAACCACC
CATTTTTCCTTTAAATTTTTCATCTAAAAGAAAAGAGGAAATTCAAGAATTGGAATATGG
AGAAATCACTAGAGGAAGTGCACCCTGTTAAGGCTTTTGGTTGGGCAGCTAAAGATACTT
CTGGGTTACTTTCCCCCTTTAAATTCTCCAGAAGGGAAACTGGGGATAAGGATGTGAAAT
TGAAGATTCTTTATTGTGGTATCTGTCATACTGATCTTCATCAAGTGAAAAATGAATGGG
GATTTTCTCAATATCCTATGGTCCCTGGACATGAGATTGTGGGTGAAGTAACCGAGGTTG
GTAGCAAGGTGGAGAAATTCAAAGTTGGGGAGAAAGCTGGTGTGGGGTGTCTAGTTGGAT
CATGTCGATCTTGTGAAAACTGCACCAACGATCTTGAAAATTATTGTTCCAAGGGAATAG
CCACCTACAATGCAATCTACCACGATGGAACACCAACGTATGGAGGCTACTCAGACATGA
TTGTTGTTGATGAACATTTTGTCATTCATGTCCCAGAAAACATGCCCCTAGCTGCTGCAG
CTCCTCTCCTTTGTGCTGGAATTACAACCTACAGCCCGTTGAGATACTTTGGACTAGATA
AACCAGGTCTTCATATTGGTGTAGTAGGTCTTGGTGGACTCGGTCATGTTGGTGTCAAGT
TTGCCAAGGCTTTAGGGCTAAAGGTGACGGTAATTAGTACATCTCAAAGCAAACAGAAGG
AAGCCATTGAACATCTTGGTGCTGATTCGTTTTTGATTAGTACTGATCCGGATCAGCTGC
AGGCTGCTATGGGCACAATGGATGGAATTCTTGACACAGTCTCCGCGGACCATCCCATAC
ATCCATTGATTGGGCTATTGAAGTCTCATGGGAAGCTTATATTTCTTGGTGCACCTGCAA
AACCTGTCGAGCTACCAGTCTTTTCATTGCTTATGGGGAGGAAGCTTGTAGCTGGAAGTG
GTATAGGAGGGATGAAAGAGACGCAAGAAATGCTTGATTTTGCTGCAAAACACAATATAA
CAGCAGATGTTGAAGTTATTCCGATGGATTATGTAAACACTGCAATGGAGCGTCTTGCCA
AAGCTGATGTTAAATACCGTTTTGTCATTGATGTTGCTAAGACCCTTAAAGCAGAATGAT
TAAGAGTTCTGCTTCATGTAATTCCAGTATTTTATGATGTTTTGGGCATAAAACAATGAT
TTTGATTACTAAGTGAAACATTGTTAAGAAAATAAATAA
EST members of Unigene FG179815  FS378000  EB450798  FS434803  FG179242  FG622431  FG179334  FG191858  EH615164  FG191948  EB681503  FS406639  EB684169  EH623013  EB680301 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase;
Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase;
Metabolism > Metabolism of Cofactors and Vitamins > ko00830
EC 1.1.1.1 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 829955 
Trichome-related Gene from Literature 829955