Detail of EST/Unigene TCNT58703
Acc. TCNT58703
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Arabidopsis thaliana E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Petunia hybrida E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Magnolia liliiflora E-value=0;
Length 1403 nt
Species Nicotiana tabacum
Belonged EST Libraries LIBEST_024954 (28 ESTs); NT_AGN_RNC (20 ESTs); NT_CHO_SL (11 ESTs); NT_AGN_RPC (7 ESTs); LIBEST_026762 (6 ESTs); NT_KL4B (4 ESTs); LIBEST_026761 (4 ESTs); LIBEST_026545 (3 ESTs); LIBEST_026715 (3 ESTs); NT_KR3B (3 ESTs); NT_KG9B (3 ESTs); NT_AGN_PNL (3 ESTs); NT_KT7 (3 ESTs); NT_AGN_ELP (2 ESTs); NT_KP1BS (2 ESTs); NB_BL12 (2 ESTs); NT_LTRI3 (1 ESTs); NT_KN6B (1 ESTs); NT_KR2B (1 ESTs); LIBEST_026713 (1 ESTs); NT_KF8 (1 ESTs); NT_EST_FLW (1 ESTs); NT_KL5B (1 ESTs);
Sequence GCCGAGTGTAATCTTCAATCATTTAAAGCCAGACCAAGACATAAACCAAGGATAACAAAA
ACGAGGAAACAAAAACTTGTATTGGGAAAAAGTAAAGTTTCATTTCTTCAATCATGACAA
GTCAAACGAAAAAAGCCCAACATTCCTCAAAGATAACACAGTTCCTCTCTGGTTATTCCA
TTACAATTAAACAAGACCACCAAACAAGAAGACCACTCCCAGCCATAGAAAACTAATACC
CCTATGATTCATCAATCAAAAACTAAAGAGGCCATTTTACCCAGCATCAAATCCTTAAGC
AACAGAAGCCATATGGCAGATCAAATCAATCACACGAGAGCTGTAACCCCATTCATTGTC
ATACCACGACACGAGTTTCACAAAGTTCTTGCTCAAGGCAATTCCAGCCTTGGCGTCGAA
AATGCTTGACCTGCTGTCACCAACAAAGTCCGTGGAAACCACATCATCTTCGGTGAATCC
CAAGATACCCTTCAACTTACCCTCTGATTCCTCCTTGATTGCGGCTTTGATGTCATCATA
AGAAGCCTCTTTCTCTAGTCTTACAGTAAGGTCCACAACAGAAACATCAACAGTTGGAAC
TCTGAAGGCCATTCCAGTCAATTTTCCATTAAGGGCTGGGAGCACTTTTCCAACAGCCTT
GGCAGCACCAGTGCTGCTAGGAATGATGTTGAATGAAGCAGCTCTTCCACCTCTCCAGTC
CTTCATGGATGGACCATCAACAGTCTTCTGGGTGGCAGTAAGGGAGTGGACAGTAGTCAT
GAGACCCTCCACAATTCCAAACCTATCATTGATGACCTTAGCCAAAGGTGCAAGGCAGTT
GGTAGTGCAACTAGCATTGGAGACAATGTCATACTCTGGCTTGTATTCCTTCTCGTTGAC
ACCCACAACAAACATGGGGGCATCCTTGCTAGGAGCAGAGATCACAACCTTCTTGGCACC
ACCCTTCAAGTGAGCAGCAGCCTTGTCCTTGTCAGTGAAAACACCAGTGGATTCCACAAC
GAAATCAGCACCAGCTTCAGCCCATGGAATTTCTTCAGGGTTCCTGATTCCAAAGACTCT
GACGGACTTCTCACCAAAAAGAAGGGTCTTTTCATCCTTGACTTTAAGCTCATGGTGTTT
CCATTGTCCATGAACTGAATCATACTTAAACATGTATGTCATGTAATCAGTAGAGATAAA
TGGGTCGTTCACTGCAACTAGTTCAACATCATCTCTCTGCAGAGCAACTCTTGCCACCAA
ACGACCAATCCTTCCAAATCCATTGATTCCGATCTTGATCTTCTTGTCAGATGCCATGGC
TTAGACAAAAAAAAGGGGGGTTTAAAGAAATGTAGGAGAGAAAATTGCTTAGTGAAAAGA
AAGAATAGTAGTGAATGTAGCTC
EST members of Unigene HO843991  DW001832  FG160283  DW003769  FG170288  DV999758  DV158665  DV162728  EH622720  FG173834  FG161394  FG177229  EH618044  EB450002  FS393131  FG166785  FG190130  FS427274  HO222906  DW000552  EH618051  EH620196  EH618049  FS386168  FS437762  FS404547  DW002597  FG166717  FS428252  EB677267  EB446540  FS428871  FS374577  FG146886  EB438345  FG177777  HS084394  FS436507  FG177157  EB449361  EB429890  FS420874  HO843768  FS414283  FG170217  FS406697  FG142270  EH617815  HS083452  EH618399  FS417437  HS083451  HS083449  FG161531  FG143735  DV160824  EH617789  EH617379  FG177697  EB677797  EH618335  FG636441  FG196549  FS436053  FG174440  EB437100  FG196461  FS396685  FG168944  FS388722  FS378390  FS378958  EB436560  HS080989  FG144089  HS080988  EB452060  FS402680  FS422742  FG160040  HS080983  HS080982  FG142853  HO841394  FG148420  FG160210  EH617305  FG177716  FG144552  EH615812  FS391489  FS406971  FS414762  EB428029  HO223885  FG138026  FG177797  HS083934  HS083935  HO844845  FG174370  DV999449  FS404154  FG132713  FS435411  FS402379  EB680270  FG160111  HO223336  FS420654  FS431671 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00134 glyceraldehyde 3-phosphate dehydrogenase
EC 1.2.1.12 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 819567 
Trichome-related Gene from Literature 819567