Detail of EST/Unigene TCNT58031
Acc. TCNT58031
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Metal tolerance protein 11 OS=Arabidopsis thaliana E-value=0; Metal tolerance protein 5 OS=Oryza sativa subsp. japonica E-value=0; Metal tolerance protein 6 OS=Oryza sativa subsp. japonica E-value=0; Metal tolerance protein 9 OS=Arabidopsis thaliana E-value=0; Metal tolerance protein 10 OS=Arabidopsis thaliana E-value=0;
Length 1597 nt
Species Nicotiana tabacum
Belonged EST Libraries LIBEST_024954 (3 ESTs); NT_DL (2 ESTs); NT_KT7 (2 ESTs); NT_LTRI3 (1 ESTs); NT_COL (1 ESTs);
Sequence CGCCATATATAGCCTCTACAACTACCCACCCAAAGAACTCCAAATTACATAAAGGTCCCT
GGAGTTCATCAAATTTACGCACTTTACCACTCCCCTGCGGCTCCTTCAAGTAGGTGCCTC
CAGTTTTTTTACCTAGTGTTTTCAACTGTTTTTTTCCCTATTTTCCGGTGACCGGAAAAT
GTTGGAAGTAGTACCTCTTCACGGCGGCGATCACGGCGCCGGCACCGAAGAGGAGCTTTT
ATTGCTGGAGACAAACAATGCCGACCGGTCATGGAGATTAAACTTCGACGAGTTGCGGTT
GTCGTCTGAATCCAAAGAGAAGCCTCCACGTGGCCTCCATGATTGCCTTGGAGTTTTAAG
TCAAGAAGACAACATTGCTGAGTACTACCAGCAACAGGTAGAAATGCTCGAGGGCTTCAA
TGAAATGGACGCCTTGACCGATCGCGGTTTTGTACCTGGGATGTCAAAGGAAGAGAGGGA
AAAAACGGCTAGAAATGAAACATTTGCCATTAGGATATCAAATGTTGCAAACATGGTTCT
CTTTGCCGCTAAAGTATATGCGTCAGTCAAGAGTGGTTCATTGGCCATCATAGCATCCAC
ATTGGATTCGCTGCTTGATCTTCTCTCTGGTTTCATATTATGGTTTACAGCTTTCTCCAT
GCAGACACCAAACCCATATCAATATCCTATTGGAAAGAAACGTATGCAGCCGTTGGGAAT
CCTTGTTTTTGCTTCTGTCATGGCGACTTTGGGACTGCAGATAATTCTGGAGTCTATGCG
TACACTAATATCTGATGAGTCTGATTTCAACCTTACCAAGGAGCAGGAGAGATGGGTTGT
TGGGATTATGGTCTTTGTGACTTTGGTGAAACTAGTTTTAATGTTGTATTGCCGGTCTTT
TACCAATGAGATTGTGAAAGCATATGCCCAGGATCATTTCTTTGATGTTATCACAAACAT
AATTGGTCTCATTGCAGCATTGCTTGCTAACTACATCACCGACTGGATAGATCCCGTTGG
AGCTATGATTCTCGCACTGTATACCATTCGAACTTGGTCAATGACTGTATTGGAGAATGT
GAACTCTCTCGTCGGCAAGTCAGCTGCACCAGAATATCTACAGAAGCTGACTTACCTTTG
CTGGAATCATCACAAGGCCGTAAGGCATATAGATACCGTGAGGGCTTATACATTTGGTTC
CACTACTTTGTTGAAGTTGATATCGTCCTGCCTGCGGACATGCCTTTGCAAGAGGCACAT
GATATTGGCGAGTCGTTGCAGGAGAAGCTTGAACTATTGCCTGAGATTGAGCGGGCCTTC
GTTCATCTTGACTACGAATACAGCCACAAACCTGAACATGCACAGGCATACCAATAGTCA
AAAGGATTTTGTGACATCTTATCTAACCAATGTACCTAATACCTCTGCATAAGTGAACTC
TGATATGCTGTTCGAGATCGGTTGATCTGGTGATTGCTCTTTAAAAGAAAATCTGGGAAA
GAAAAGGCTGCTATGATCTGGATGTTCCCTAGAACAAGTAATATGAATTATTATTTTTTT
AAATTTTACCTTGCCTATTCATATATATAACATGATT
EST members of Unigene EB450550  FS417197  FG637739  EB450974  AM822382  FS424006  FS425229  AM786795  AM847309 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family 2.A.4 Cation diffusion facilitator CDF
Probeset
Corresponding NCBI Gene 818530 
Trichome-related Gene from Literature 818530