Detail of EST/Unigene TCNT57823
Acc. TCNT57823
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=0; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=0; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=0; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=0; Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) E-value=0;
Length 1697 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_AGN_RNC (2 ESTs); LIBEST_024954 (2 ESTs); LIBEST_023330 (1 ESTs); LIBEST_026762 (1 ESTs); NT_DL (1 ESTs); NT_KT7 (1 ESTs); NT_KP1BS (1 ESTs); NT_KR3B (1 ESTs); NT_MAT005 (1 ESTs); MT_CDS (1 ESTs); NT_LTRI3 (1 ESTs); LIBEST_026761 (1 ESTs);
Sequence CAAGCATATAGAGTTAGTACTAAATCTAGCAAATGTGGTGGTGCTCTTGCTGCAACATGT
CGCGCCGAGAAGATTCTGGTGGCAAATCGAGGAGAAATTGCTGTTCGTGTGATTCGAACT
GCCCATGAGATGGGAATTCCTTGTGTTGCTGTTTATTCGACCATAGACAAAGATGCCTTA
CATGTGAAGCTAGCTGATGAATCTGTTTGCATTGGTGAAGCACCAAGCAATCAATCGTAT
TTAGTGATCCCAAATGTCTTATCTGCTGCTATCAGTCGTGGATGTACAATGTTGCATCCT
GGATATGGTTTCCTTGCTGAGAATGCAGTTTTTGTTGAGATGTGCAGAGAACATGGAATC
AACTTTATTGGGCCAAATCCAGACAGTATTAGAGTCATGGGTGACAAATCCACTGCCAGA
GATACAATGAAGAATGCTGGTGTTCCAACTGTGCCAGGAAGTGATGGACTATTACAGAGC
ACTGAAGAAGGTGTAAGGCTTGCTGAGGAGATTGGTTACCCTGTGATGATTAAGGCAACA
GCTGGTGGTGGTGGACGTGGAATGCGTCTTGCTAAAGAACCTGATGAGTTTGTAAAATTA
TTACAGCAAGCTAAAAGTGAAGCAGCTGCTGCATTTGGAAATGATGGCGTTTATCTGGAG
AAGTACGTCCAAAATCCTACGCACATTGAATTTCAGTTTTGGCGGACAAGTATGGTAATG
TTGTACACTTTGGAGAGCGTGATTGCAGTATTCAGAGAAGGAACCAGAAGTTGCTGGAGG
AAGCACCTTCCCCTGCATTAACACCAGAGCTAAGGAACGCCATGGGTGACGCAGCTGTTG
CGGCAGCAGCATCCATAGGTTACATTGGTGTTGGTACCGTGGAGTTCCTATTGGATGAGA
GAGGGTCCTTTTACTTCATGGAAATGAACACTCGTATTCAGGTAGAGCATCCAGTGACAG
AAATGATATCCTCTGTTGATCTGATAGAGGAACAGATCCGTGTGGCTATGGGAGAAAAGC
TCCGATACAAACAGGAGGATATTGTGCTTAGAGGACATTCAATTGAATGCCGTATAAATG
CAGAAGATGCTTTCAAAAATTTCAGACCCGGACCAGGGAGAATCACTGCCTATTTACCAG
CTGGAGGTCCATTTGTGCGTATGGATAGCCACGTTTATCCTGACTATGTGGTTCCACCTA
GCTACGATTCCCTGCTAGGAAAGCTCATCGTATGGGCTCCAACACGCGAGAGGGCTATTG
AACGCATGAAAAGAGCACTTAATGACACCATAATTACTGGAGTTCCTACCACAATAGAAT
ATCATAAGCTCATCCTCGATATTGAGGACTTTAAGAATGGAAAGTTGATACCGCTTTTAT
TCCAAAGCATGAAGAAGAATTAGCTCCGCCCCAGCAAATGGTTCCAGCAGCTACCAAGGA
GATGGTCAATGCTAGTGCTTAATTCTTCCTCTTCTTTTTTTTGTTTTTTTTCTTTGATAT
TTTTCCTTTACCATAGTCAGCGAATAGTGAAAGCAGATTGCTTCCATTAGATCTTGAGGT
GACTGTAGTTCTGGATATAATATTCATCTCTTTGATCTTAGCTTGAATGTATTTTTAGAT
ACCCAAGACTGAATGAAATTCTTTTTTTGGCCGTTGCCTTGCTATATGATGCTCCATCGA
ATGGCAGTCGTTTTTGC
EST members of Unigene TOBBCSO  FG638212  FG622805  BP530361  FG164101  EB683287  HS084919  AM814678  FS383121  FS398063  EB449898  FG150962  DV159322  HS082448 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01968 3-methylcrotonyl-CoA carboxylase alpha subunit
EC 6.4.1.4 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 833497 
Trichome-related Gene from Literature 833497