Detail of EST/Unigene TCNT57777
Acc. TCNT57777
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Solanesyl diphosphate synthase 3, chloroplastic/mitochondrial OS=Arabidopsis thaliana E-value=0; Solanesyl-diphosphate synthase 1, mitochondrial OS=Oryza sativa subsp. japonica E-value=0; Probable hexaprenyl pyrophosphate synthase, mitochondrial OS=Yarrowia lipolytica (strain CLIB 122 / E 150) E-value=9e-56; Decaprenyl-diphosphate synthase OS=Dictyostelium discoideum E-value=7e-55; Probable hexaprenyl pyrophosphate synthase, mitochondrial OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=9e-55;
Length 1707 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_AGN_PNL (4 ESTs); NT_AGN_RNC (4 ESTs); NT_COL (3 ESTs); LIBEST_024954 (3 ESTs); NT_AGN_RPC (1 ESTs); NT_AGN_ELP (1 ESTs); NT_SL (1 ESTs); NT_TRI (1 ESTs);
Sequence GCAAATTAAAACACGAGTCCGTTAAATTTCATGCCTTTTTTGGGTTCCTCAAACCCTGGG
GCACCGCTTTACTTTGACCTTTCCTCCTTCCCTCGTTCTCCTTTTTCTTCTTCTACTAGC
GACACATACTAAGCACACACAATAATAACACATACAAAAATAAGTAAATCGAGAATGCTA
TTTGCAAGGGGTTTGTCTCAGATTTCGAGACGCAGTATCAATAGATATCAATGGCTATGT
CCCCAGCAACAACAATTTCACCATTCCAATCACTTTCCCTCTCCCATCGATGCTTCTCAT
AAGGTTTTGGGTTGCAGAGTAATTCATTCATGGGTTTCTAATGCTCTTAGTGGTATTGGT
CAACAAATTCATCATCAAAGCACTGCTGTAGCAGAGGAGCAAGTGGACCCATTTTCCCTT
GTTGCTGATGAATTATCCCTTCTGACAAACAGGCTGAGATCAATGGTAGTTGCCGAGGTC
CCAAAGCTGGCTTCAGCTGCTGAGTATTTCTTCAAAATGGGAGTAGAAGGGAAGAGGTTT
CGACCCACAGTTCTGCTGTTGATGGCAACGGCACTGAACGCACCGGTACTTAGACCCCAG
GTGGATGTTGATTCTTTGTCCAGGGATTTGCGTACCAGGCAGCAGTGTATAGCTGAAATC
ACCGAGATGATCCATGTTGCCAGCCTACTCCATGATGATGTACTAGATGATGCTGACACA
CGACGTGGGATAGGTTCTTTAAACTTTGTGATGGGAAATAAGTTAGCTGTACTAGCTGGA
GACTTTCTGCTTTCCCGAGCGTGTGTGGCACTTGCCTCTTTGAAGAATACAGAGGTTGTA
TCCCTTCTGGCAACTGTTGTGGAACATCTTGTTACTGGAGAGATAATGCAAATGACGACT
TCTTCGATGACGTTGTAGCATGGAGTATTACATGCAGAAAACATATTACAAGACTGCGTC
ATTAATTTCAAACAGTTGCAAAGCAATAGCGCTACTTGCTGGGCATACTGCTGAAGTCTC
CATGTTGCTTTTGACTATGGGAAAAATTTGGGCTTGGCATTTCAATTAATAGACGATGTT
CTTGATTTCACAGGCACATCTGCCACCCTCGGCAAGGGTTCATTGTCTGATATTCGTCAT
GGGATTGTAACTGCCCCAATATTGTATGCCATGGAGGAATTTCCTCAACTGCGAACGGTG
GTGGACCGGGGATTCGATGATCCTGTCAATGTGGAGATTGCTCTGGACTACCTTGGTAAG
AGCCGAGGGATACAGAGAACAAGAGAACTTGCAAGAAAACATGCTAACCTTGCCTCAGCA
GCTGTTGACGCTCTTCCTGAGAGCGATGACGAGGATGTTCAGAGATCAAGACGGGCACTT
GTGGAACTTACTCAAAGAGTCATCACAAGAACAAAATAGTGGGAAAAGGGGAATCTATCC
AGGTGCAGCCACATTTGATTAGTGTACGAAAATTTTGTTTTAGACTCAACACGTACTCCT
GTATTTCTAGGGACAACAGACCCTATTTTTAGATCATGCTTTTCTTCTAGATAGATAATT
TATGATATTTTTTCATCCAATAATTATTATTTGGTAAAACCCTTGATTTTTCTTTTTTTC
TGTACTGGGAACAAGTCTGTAGAGTAAATGTGATACACATCGATGTTGTAAAAGGTTATC
CAGCTGAAAGTAAATGGATGTATCCTT
EST members of Unigene FG171939  FG152415  FG191538  FG171867  FG191445  FG638804  FG193263  FG145324  FS409035  AM812461  FS410914  FG193353  AM836265  FG152355  AM803527  FG138211  AM795677  FS388023 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 2.5.1.- 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 818028 
Trichome-related Gene from Literature 818028