Detail of EST/Unigene TCNT57306
Acc. TCNT57306
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=0; Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutathione synthetase OS=Xenopus laevis E-value=3e-75; Glutathione synthetase OS=Homo sapiens E-value=2e-72;
Length 2073 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_AGN_RNC (6 ESTs); NT_KR3B (3 ESTs); NT_AGN_PNL (2 ESTs); NT_K326_LSL (1 ESTs); NT_DL (1 ESTs); NT_KR2B (1 ESTs); NT_AGN_RPC (1 ESTs); NT_SL (1 ESTs); LIBEST_024954 (1 ESTs); NB_BL12 (1 ESTs);
Sequence GGCACTTTGGACGATAATAAGGTAACACAAAAGAGGGGTCCAAAGAATGTCAAAATGGGC
AGCGGCTATTCCTCTTCATCTTTCTCACAAAGCAGCAGCACTTTAGCGCAGTGTTGTGCT
ACCGTTCCTTTACAACTCCAAGAATCACACTCAAACTCTTTAAATTTCTGCTCCGCTACT
AGATTCTTGGAACCCCATCTTATTAAATCTTCCAAAATTCTAATACCCAAATCCCCATTT
TCAGCAATTTTGCCATTGAAGTGTGCTAAAAAAATGCAGACCCAAGTGGAAGATTCTGTG
AAACCCATTGTTGATCCTCATGATATTGACCCGAAATTGCTGCAGAAACTTTCTTATGAT
GCACTTGTCTTTTGCTCTCTTCGTGGTCTTGTTGTTGGTGACAGAAATTCAGAGAGGTCA
GGAACTGTTCCTGGTGTTGGTATGGTTCATGCTCCAGTTGCTCTTTTACCAATGTCATTC
CCTGAAAGTCAATGGAATCAAGCTTGTGAAGTTGCTCCTATTTTCAATGAGCTCGTCGAT
CGTGTGAGTCAGGATGGAGAATTTTTGCAGCAATCACTCTCTAGGACGAAAAAAGTTGAT
CCGTTCACCTCCAGACTACTAGAAATCCACTCCAAGATGCTACAAATCAATAAGAAAGAG
GAAATACGCTTGGGGTTGCATCGCTCAGACTATATGCTGGATGAGCAAACTAAATTACTT
CTGCAAATAGAGCTTAACACTATTTCATCATCATTTTCGGGGCTAAGTTGTCTTGTCAGT
GAGCTTCACAGGAGCTTGCTTCATCAATACAGTGAATGCATTGCATTAGATCCTAACAAA
ATTCCCACAAACAATTCCGTAAATCAATTTACGGATGCACTGGCTAAAGCTTGGAATGAA
TATGGTGATCCAAGGGCTGTGGTTATGTTTGTGATTCTAGCTGAAGAGCGCAACATGTAT
GATCAGCATTGGCTTTCGGCTTCACTGGGAGAAAAACATCAAGTTACAACTATCAGAAAG
ACGCTAGCGGAAATTGATGCACAGGCGAGCTTCTAGAAGATGGTACCCTCATTGTAGATG
GTGAAGCAGTGGCGGTCATTTATTTTAGAGCTGGCTATGCACCAAGTGACTATCACTCGG
AATCTGAATGGAGCTAGGCTTCTGATGGAGCAGTCACGTGCAGTCAAGTGCCCGTCAATT
TCCTATCATTTAGCTGGGACCAAGAAGATTCAGCAAGAGCTTGCAAAACCCAATGTACTA
GAAAGGTTTCTTGAAAACAAAGAGGCCATTGCCAAACTACGAAAATGCTTTGCAGGGTTG
TGGAGTTTGGATGAATCCGACACAGTCAAGGATGCAATTGAGAGACCTGGCTTGTACGTA
ATGAAACCACAACGAGAAGGAGGAGGAAACAATATCTATGGGGAAGATGTGAAGGAAGCT
CTTCTGAAACTGCAGAAGGAAGGCACTGGAAGTGATGCGTTTATACTAATGCAGAGGATT
TTTCCAACCGTTTCTCACTCGATACTAATGCGAGAAGGCATCCCTCATAAAGAGCAAACC
ATATCTGAACTTGGGATATATGGAACTTATTTAAGGAACGAAAAAGAAGTTCTGATCAAT
CAACAGTCGGGTTACTTGATGCGGACAAAGGTCTCTTCATCAAATGAGGGTGGGGTTGCT
GCTGGTTTTGCAGTGTTGGACAGTATATACTTGGTTTGATGAGATTGGCTCTTGCATTGT
TACTGGGGTTGAATGCGGAGGCTGCATCAGTCTTTCCTACATTACATTGGAATGACATGG
TTTTAGCTTGTTCAACCTTGTTTTCTTAATAAATAGAGTTCCATATGTTTTCTGAAAGAA
GTGGACACAAGATAGACAGTAGATCCAAAGTTCTTATTTGTAAACACAATTCAGTGCTCT
CTCTTTGTTTACGCAAGGGCTTTACTTATCTGCTACAAGCTGATCACTGAATTTGAACGT
ATCTGCGCATTACTCATGTTATTTACATTTGCTTGTAATACCATGCTTAAGCGATAAATT
TATATGAGAATCTGTATTGATTAAATATGGTTT
EST members of Unigene EB444614  FG173221  AM823571  FG173173  FG173121  EB437755  FG143805  DW005071  AM825670  FG184922  FG173284  FG644901  DW004650  FG174100  FG174172  DW002504  FG185014  FS399600 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K01920 glutathione synthase
EC 6.3.2.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 832797 
Trichome-related Gene from Literature 832797