Detail of EST/Unigene TCMT58974
Acc. TCMT58974
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=0; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=0; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=0; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=0; Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) E-value=0;
Length 2188 nt
Species Medicago truncatula
Belonged EST Libraries MT_GESD (6 ESTs); MT_DSTEM2 (3 ESTs); MtBC_GLOMUS (3 ESTs); MT_Shoots (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_NOD_NOLLY (2 ESTs); MT_VILEAF (2 ESTs); MT_SROOT_KV1 (2 ESTs); MTFLOW (1 ESTs); MT_ECELL (1 ESTs); MT_TRI (1 ESTs); MT_DFLOWER (1 ESTs); MT_DSIL (1 ESTs); MT_SROOT_KV2 (1 ESTs);
Sequence GCATGAGGGAGCTTTCAACTAAGCATAGCATAGACACAGTCACACCCTCAACCTCGTTTC
CATCGACACCAATATACTAACTAAATCACACTTCAAAAACCCTATTCCAACACATTTTCA
TTTTCATTTTCCTATTGGTATTGTAGAAACAATTATGGAGGCAACAATGTCCGCAGCCTG
CAATTCTCTCACCTCACCATCCACCGTCACAGGTTTATTTGCGACGAGAGGAGGAGGATT
GAACAAGAATTCACATTCTCAGTGCACTTTCTTGACCGGAACAAACAAGCTGAAGTTTCC
GAGGCAAACTACTCAACCTTGTAAACAACGCCAAACGCGTCATTGCGGTGCTCTTCGTGC
AACTTGTCGTCTTGAGAAGATATTGGTTGCCAATCGAGGCGAGATTGCTGTTCGTGTTAT
TCGTACTGCTCATGAATTGGGGATTCCTTGTGTTGCTGTTTATTCCACCATTGATAAAGA
TGCTCTTCATGTTAAATTGGCTGATGAATCTGTTTGTATTGGTGAAGCTCCCAGTAGCCA
ATCGTATTTAGTGATTCCAAATGTTCTGGCTGCTGCTACCAGCCGCCAATGTACAATGTT
GCATCCTGGATATGGTTTTCTTGCAGAGAATGCTGTTTTTGTTGAAATGTGTAGAGATCA
TGGAGTCAATTTTATTGGACCTAACCCTGACAGTATTCGGGTTATGGGTGACAAAGCAAC
TGCAAGAGAAACAATGAAGAAAGCAAATGTTCCTACTGTTCCAGGAAGTGAGGGGCTTTT
GCAGACCACTGAAGAAGCTATCAGACTGGCACACGAGATTGGTTTCCCTGTGATGATCAA
GGCAACCGCAGGTGGTGGAGGACGTGGCATGCGTCTTGCTAAAGAACCTAAAGAGTTTGT
GAAGTTATTACAGCAAGCTAAGAGTGAGGCAGCTGCTGCATTTGGAAATGATGGGGTTTA
TTTGGAGAAGTACATTCAAAACCCAAGGCACATTGAATTCCAGGTTCTTGCAGATAAATA
TGGTAATGTTGTTCACTTTGGAGAACGTGATTGCAGTATCCAGAGGCGTAATCAGAAACT
GCTCGAAGAAGCACCGTCTCCTGCATTGACCCCAGAGTTACGGAAGGCAATGGGAGATGC
AGCAGTTCAGGCTGCCGCATCTATCGGTTACATAGGTGTTGGAACGGTTGAGTTCCTTTT
GGATGAAAGGGGTTCTTTTTACTTCATGGAGATGAACACTCGTATCCAGGTTGAACATCC
CGTGACAGAAATGATTTCCTCAGTTGATTTGATAGAAGAGCAAATTCGTGTAGCTATGGG
AGAAAAGCTTCGATACAAACAGGAGGATATTGTACTCAGAGGACATTCCATTGAATGCCG
TATCAATGCAGAAGATGCTTTCAAGGGATTTAGACCAGGGCCAGGTAGAATTACAGCATA
CTTGCCGTCTGGTGGTCCATTTGTCAGGATGGATAGCCATATTTATCCTGATTATGTTGT
TCCTCCAAGCTATGACTCTCTTCTTGGAAAGCTGATTGTATGGGCTCCGACTAGAGAAAA
AGCAATTGAACGCATGAAAAGGGCACTCGATGACACTATTATCACAGGAGTTCCTACAAC
AATTGATTATCATAAACTTATCCTTGACATAGAGGATTTCAAAAATGGCAAGGTTGATAC
TGCTTTTATTCCAAAGCACGAGGAGGAGTTGGCTGTGCCCCCACAACAGAAGATGGTATT
AGTTAACAAGGTGGTGACAGAACCAGCTGGCTCGACTGCCTGATGGATATCATGACTATG
TGATGACGCCCTATAAAGAATTTGCACTGTTGTAATCAATATGTTGTCCGTGTGTGCTTG
AGAAAGTTCTAATGAAATTTTGATAATTAGTCTCCCATAATTATCCGTCCAATAATTATT
TTGTAAAATGGTTAATTAATTTCATGTTTAATTTATCACCCCGAATATTAGTGCTAGGTT
ATGGGATTTCACCATGATTTTAGATGATTGTTGTCTCATTTCATGTTTTGTAATTCTTAT
ATTAAGAACACACTTTTAGATAGAGTAATAAACTGCATCATATCTAGCAAGTTGAATTTC
AGGCATGTTTCAATTTGTGTCACTAGACTATTATAAATCTAGCTTTTTGTGAAATTTTAA
ATATATTTTAATGATCTTTTGTCGTTGT
EST members of Unigene DY618286  DY617468  AL387836  AL387835  AL386952  CX527210  CX524948  AW692973  AW693625  AW690426  BG447793  CA990912  CA918607  CA918606  CA918605  CA918604  CA918496  CB891484  AW774220  BQ147365  AW775542  AW257383  BE204579  BE187648  CX517289  CX516690  BF004138  BE203085  AJ497421  GE350041  GE345039  EX529254 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01968 3-methylcrotonyl-CoA carboxylase alpha subunit
EC 6.4.1.4 
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.49864.1.S1_at
Corresponding NCBI Gene 833497 
Trichome-related Gene from Literature 833497