Detail of EST/Unigene TCMT56456
Acc. TCMT56456
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=0; Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutathione synthetase OS=Xenopus laevis E-value=2e-93; Glutathione synthetase OS=Homo sapiens E-value=1e-89;
Length 2025 nt
Species Medicago truncatula
Belonged EST Libraries MT_CDS (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_Drought (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); MT_ECELL (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_GPOD (1 ESTs); MT_JAS_ROOR (1 ESTs);
Sequence GAAATTGAAATGAAACTCAAATTTGATACGATGTTGAAGCAATAGGCAATGGCCTGCTTC
TGCTTTTGGTTTTGGTGGTATTAGATTCTCCAAGACTATACCTTTGTCCAAATACATTCC
TCCTCTTCAGCCTCATCACAACAACACCTTTTTCTCTTTCTTTCCTTCTTCTTCTTCTTC
TTCTTCTTCTTCTTCTTCTTCTTCTATAAATTTCTCTACGAAACCACTTCCAATGTCTCA
TCATAAGCATCTCACCATTAATGGTGATGAACAAAACATCATTAAACCTTCTCCTCTATT
CGTTGATGATTATCACAATATTGATCAACAACTTCTCGATAACATCGCTTATGATGCTCT
TGTTTGGGCCTCTCTTCACGGTCTTCTCATGGGAGATAAATCTTACCAGAAATCAGGAAT
GGTTCCTGGTGTTGGATTGATGCATGCCCCGTTTTCATTATTCCCAACGTCGTTTCCAGA
AAGTAAATGGAAGCAAGCTTGTGATTTGGCACCTATATTCAATGAACTTGTTGACCGTGT
TAGTTTAGATGGTAAATTTCTTCAAGAATCTCTCTCAAGAACTAAGCAAGTGGACGAATT
TACCTCTAGACTTTTAGATATTCATTCCAAGATGCTACAGCTCAACAAAAAAGAGGAAAT
AAGATTTGGATTACATCGTTCAGACTATATGCTTGATGAACAAACCAAATCACTTTTGCA
AATAGAGCTCAACACTATTTCATCTTCATTTGCTGGTTTTAGTACTCTTGTCACTCAACT
TCATAGGTACATACTTACTTGCCATGGAAAATTGCTTGGTCTGGATTCAGAAAAGGTTCC
TGCCAATAATGCTGTCAGCCAGAATGCCGAGGCCTTGGCTAAAGCTTGGAGTGAGTATAA
TAACCCAAGGGCTGTGATTATGACTGTGGTTCAGGCTGAAGAGCGAAACATGTATGACCA
GCATTTTCTTTCTGCTGTTCTAAGAGACAAGCATGGTATTACAATTGTTCGTAAAACGAT
GGCAGAAGTTGACCAAGAAGGAGAAATTCTACCAGATGGAACACTTTCTGTTAATGGACA
AGCAGTTGCAGTAATTTACTTCAGGGCTGGCTATACACCAGTTGATTATCCTTCAGAATC
AGAATGGAGAGCTAGACTATTGATGGAACAATCTTCTGCTGTCAAATGCCCTTCAATATC
GTATCATTTGGTTGGCACCAAGAAGATTCAACAGGAACTTGCAAAGCCAGGTGTTCTTGA
GAGGTTCCTTGAAAACAAAGACGATATCGCAAAAATGCGTGAATGCTTTGCAGGACTATG
GAGTTTGGATGACTCAGATATTGTTAAAAAAGCAATTGAACGACCCGAATTATTTGTGAT
GAAGCCCCAGAGAGAAGGAGGAGGAAACAATATTTATGGTGATGCAGTGCGAGACACCCT
CATAAAATTGCAGAAAACGGGTTCTCAAGAAGATGCAGCTTACATACTTATGCAGAGGAT
ATTTCCAAATATTTCTGCTGCAGTTTTGATGCGTAATGGTGGTTGCCACAAGGACCACGC
CATCTCAGAACTTGGGATATTTGGTACTTATTTAAGGAATAAGGATAGGGTTGTTATGAA
TAATCAAAGTGGCTATTTGATGCGTACGAAAATATCATCATCTGATGAAGGTGGGGTTGC
AGCTGGTTTTGCAGTAATAGATAGTGTATACCTCACTTGACGTAGAGCACCTCTAACTTA
TCTGGGTATATTATCAACACATTGTGTTTACACATTACCATTTGAGCCTCCTGTTTATAT
TTGTCTGCCTCCGCAAAAAATTGAAAGGGAGGCCACATTGCTTATTTTACGTTATCCCAT
AGTGTGTTGTATAGTTGCACAAAAATAACCTGTTAAAGCTTTTTGCTCAAAAAAACTTGT
TAATGCTTCCGAAACAGTACTAAAGAAGCCCATAAAGATTGATGATCTGGGTAAACCTGT
TCATTCTTATTGAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAA
EST members of Unigene BT052916  AF075699  CA922806  CX528274  BF649591  EV258256  EV256199  BE998473  BI308380  CX532597  BG451005 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K01920 glutathione synthase
EC 6.3.2.3 
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.40809.1.S1_at
Corresponding NCBI Gene 832797 
Trichome-related Gene from Literature 832797