Detail of EST/Unigene TCMT55739
Acc. TCMT55739
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=0; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=0;
Length 1444 nt
Species Medicago truncatula
Belonged EST Libraries MT_JAS_ROOR (45 ESTs); MT_HOGA (5 ESTs); MT_UV-B (4 ESTs); MT_DSIL (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs);
Sequence GGAATATCGACAATAACATATACTTTCATTACTACTCAAAGAGACACAATTCATTCGCTT
ACTTAATTTTTGTCACGTTGAAATGGCAACACAACCTGAATTTGAACATCCAAACAAGGC
ATTTGGTTGGGCAGCTAGAGACACTTCTGGTGTTCTTTCCCCTTTCAACTTCTCCAGAAG
AGAAACGGGTGAAAAAGATGTGGCATTTAAAGTACTGTATTGTGGGATATGTCACTCGGA
TCTTCATATGATAAAGAATGAATGGGGCATGTCTACCTATCCACTAGTTCCTGGGCATGA
GATTGCTGGTATAGTGACGGAGGTAGGAAGCAAAGTAGAGAAGTTCAAAATTGGAGACAA
AGTGGGTGTGGGATGCTTAGTTGATTCGTGTCGTGCATGCCAAAACTGTGAGGAAAATCT
TGAGAATTATTGCCCTAAACAAACAAATACATATAGTGCCAAATACAGTGATGGAAGCAT
CACATATGGAGGGTACTCTGACTCAATGGTTGCAGATGAGCACTTTATAGTTCACATTCC
TGATGGCTTACCACTTGAATCTGCTGCTCCTCTCCTTTGTGCCGGTATTACTGTGTATAG
TCCTCTTCGATATTTTGGACTCGACAAGCCTGGTATGAATATAGGTATTGTTGGTCTTGG
TGGACTTGGTCACTTGGGTGTGAAGTTTGCAAAAGCTTTTGGAGCTAATGTAACAGTAAT
TAGTACATCACCCAACAAAGAGAAAGAAGCAATAGAAAACCTAGGAGCTGATTCATTTCT
TATAAGTCATGACCAAGATAAAATGCAGGCTGCGATGGGTACTTTGGATGGCATCATCGA
TACAGTTTCAGCGGATCATCCTCTCTTACCTCTAGTTGGTTTATTAAAATATCACGGAAA
ACTTGTAATGGTCGGTGCACCTGACAAGCCTCCGGAGCTCCCTCACATTCCTTTAATAAT
GGGGAGAAAGACGATATCTGGCAGTGGCATTGGAGGCATGAAAGAGACACAAGAAATGAT
TGATTTTGCTGCTAAACACAATATAAAACCAGACATCGAAGTCATACCAGTGGATTATGT
TAACACAGCAATGAAGCGACTCCTCAAAGCAGATGTCAAATATCGATTTGTGCTCGATAT
CGGAAACACTTTAAAACCTAGTTCTTAACTTTTGTACAACTCCACTGTCTGTTGTTCGGA
TCACCATCACAATTATTACGATTTTTGTTTGTTTATCCAATTTTTTTTAAGGATGTTTGT
TTATCCAATATTGTCGATTGTTTTTTCTTCTTCTTGTATACAATAAAGGTTTTTGATCTT
GGACAGAGAGCGTCTGCGGTTGAAAATCATAGGGATTCAAATTCAGCACTATTCACATAT
ATGTGAATGAATAATGTATTTTCTGTTATAGAATAATGTATGTGTTTTATGATGTGAAAA
AAAG
EST members of Unigene BT051955  CA918668  EV256878  DY632840  DY632834  DY632825  DY632823  AW685108  BQ141351  BF518832  AW775567  CX535483  CX535132  CX534823  CX534758  CX534401  CX534245  CX534230  CX534165  CX534117  CX534098  CX533935  CX533856  CX533542  CX533536  CX533221  CX533194  CX533156  CX533153  CX533001  CX532975  CX532957  CX532837  CX532727  CX532435  CX532226  CX531509  CX531325  CX531224  CX531069  CX531013  CX530797  CX530759  CX530705  CX530697  CX530366  CX530256  CX530243  CX530142  CX530086  CX529957  CX529692  CX529445  CX529284  CX528957  CX528714  CB895197  CB892983  CB892910  BG648409  BG646738  BG450274  EY477277  GE352673  GE348396 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase;
Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase;
Metabolism > Metabolism of Cofactors and Vitamins > ko00830
EC 1.1.1.1 
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.8517.1.S1_at
Corresponding NCBI Gene 829955 
Trichome-related Gene from Literature 829955