Detail of EST/Unigene TCMT53557
Acc. TCMT53557
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) RNA polymerase II C-terminal domain phosphatase-like 3 OS=Arabidopsis thaliana E-value=4e-60; RNA polymerase II C-terminal domain phosphatase-like 4 OS=Arabidopsis thaliana E-value=2e-27; RNA polymerase II subunit A C-terminal domain phosphatase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-07;
Length 1952 nt
Species Medicago truncatula
Belonged EST Libraries MT_NOD_GVN (3 ESTs); MT_DFLOWER (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_SEEDROOT_KV3 (1 ESTs);
Sequence GGCCCCTCTCTTCTTGAGATTGACCACGACGAGAGACCTGAATCTGGAACTCTGGCATCC
TCTTTGGGGGTGATTGAGAGAATACACCAAAACTTTTTTGCGTCTCAATCCTTGGAAGAA
GTGGATGTCAGAAATATCCTAGCTTCAGAACAGAGGAAAATCTTGGATGGTTGTCGTATA
GTATTTAGTAGGATGTTTCCTGTTGGTGATGCCAATCCCCACCTTCACCCATTGTGGCAG
ACAGCTGAACAATTTGGTGCTTCTTGCACAAACCAAATTGATGATCAGGTTACTCATGTA
GTTGCTCATTCCCCTGGGACTGATAAGGTGAATTGGGCTATTGCCAATGGAAAATTTGTT
GTCCATCCTGGCTGGGTGGAAGCATCAGCATTGCTTTATAGACGGGCTAATGAGCAAGAT
TTTGCCATTAAACTAGACAAATAACCACCTAATAATCCTCTGGTAAATTAAAATACGTGA
AACGTAAATCAATCACATTGATTTCGGGTGTGTGAATTCATTAGGTCCGAACTGGTCAGG
GAAAACAGTTTTAAATTGTGACCGCCTGTCCATTGGAGGTGGTTATTGGTGAGTGGGTAT
TTATTTGGCTGGCCCGATGCTGAGGAGTTTACGGAGGAATGTATAAATGCCCTTTGATTG
TTGGGATTTTCCTACTGGCTTTGGTGGCTACGGTGGGCCTGAGAAAATGAGTTGACTGCT
TTAGGGACTAGGTGAGTGTTATTGTGGGGATGACTTATGTGAACCAGAGATGGTGACAAG
AGGGAAATATACATCTGCCGACAGTAAAATTAGAGGCCTCTGCATTTAGAGTGTTAAAAT
ATGGAAGAATTCAGACTGAAGATATATTGACTAAACTAATTTAGGAAATTTTTTCCTTGA
TTAGTCCTTGAGTCTAAGGAGGTGAGGGCGCTAGACAAAGTCAGGATTTTTTTGGAGGTG
GATAGTTGGCCCAGCAAATTGAGTTTCTTATAATTGAATTTGTATAACAAAATGTGACTG
CATAAAGCATTTTAGGGGGATGAAATTAATTACCATTCACCATTCCCTCCCCCAAAAACA
AATAAAGTTGGTTAGGGAGGGAGAGGATAGAAAATGATAGAAAGTGTGTCTAAAGTCTAA
CCACAAATTGTAGTCAAGGTCTTTTATCCCATTGGTTGCTTCAGCCTTCAATTTATGCCA
GGATTTGTCTTTAAAACAAACCCAATTGGAAAATTTTGAGAATTTGTAAAAACGGCAATA
TCATTCATCATGTTATTTTTGCTGAGAATCCCATTATGGCCAAAACAGTAAGAAGTTTGA
AAAAACAGTATCTAATGTTCCTAAAGGATAATAATGGAGAGATTCCTGCGCATTACTGAA
AAAGAACTACGCAAAGGTTACCCTGATGTTGTCTTTGTTGTGTTGCCTGTTCAAATTTAG
AAACATTAATGGTCCCATATTCTCTGTCAGGTTCTCCTAGCTGTGGCATCTGTCATGCAG
TTGCAATGTCTGTCGATGGAAACTTGTCATTCCAATAAATTAAGGCAACTGTACCGTGGT
GTTTCAGAAGCAAGAGATTCTAGTGTTGAGTGATAACACCTTCAATAATAATGTGTTAAG
AAACACTGGATAAGTGTGTTTCTATTGCTGTTTGCTTCCTACCCAAACCACTCTACATGT
TTGAGGAAACATTTCCATTCTGTCTTATTCTAACTCTGTTTTACCCTTCTACTTGAAGAC
ACATCTTTAAGACACAGCCTTTTAACTTGTGAGTTTTGTTCTTTAAGACACATCTTTGGA
GTGTTCAGTGGCTATAAAAACACTAAAAGGGCTACACACATCTTTTCTATCGTGAAGCTA
GTTACCTGGTTGGTTATTTAATGGATGCAACCAAAGGAGGATCGAGCTATAGTCAATGTT
CCCTTAATGTAACCAAGTTTTGATTTGAAAAT
EST members of Unigene CF069276  CA919808  BG580517  BG580395  AW574179  CB891074  BQ148802  BQ148009 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.1.3.16 
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.47380.1.S1_at
Corresponding NCBI Gene 817919 
Trichome-related Gene from Literature 817919