Detail of EST/Unigene TCMT52922
Acc. TCMT52922
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Glutathione synthetase, chloroplastic OS=Brassica juncea E-value=0; Glutathione synthetase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutathione synthetase, chloroplastic OS=Solanum lycopersicum E-value=0; Glutathione synthetase OS=Xenopus laevis E-value=3e-83; Glutathione synthetase OS=Homo sapiens E-value=3e-81;
Length 2017 nt
Species Medicago truncatula
Belonged EST Libraries MT_ECELL (3 ESTs); MHRP-root (3 ESTs); MT_JCVI-MT1 (2 ESTs); MtBA (2 ESTs); MT_DROOT (2 ESTs); MT_IROOT_DSIR (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_ROOTPHOS (1 ESTs); MtSNF (1 ESTs); GLSD (1 ESTs); MT_CDS (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT3 (1 ESTs);
Sequence CATCACCCCCACCACCTTCACCACCTCCTCCAGTTTACTTACCACCACCTCCTCCACCGT
GAAGGTCAATGGTTGCTGGATCTGGGTGCTTGGTTTGGTTTCCTCACTCGTGCACTAACA
TTTTTCCTTCATCTTTCGTCTCGTCTACTTCCCAACACCATAGATCAGTACTGTCACTTT
TCTTTCCTAAAAATAGAAACATGTCTCAACAACAGCTGAACCTGAGTTCTACTACCACAA
ACATAGAAGTAGAAGTGGTTGATAATTCTCCTCCCATGACGCTTCCCAGCTTTAATGATT
ATCATCAAATAGATGACAAAGTTCTTGAAAACATTGTTTATGATGCTCTTGTCTTTGCCA
CTCTCAATGGTCTTCTTGTTGGGGATAAATCTGTTGAGAGATCAGGAAGAGTTCCTGGTG
TAGGGTTGGTGCATCTTCCATTTTCCTTACTTCCTCCCCCTCTTCCTGAAACTCATTGGA
AACAAGCTTGTGATTTGTCACCTTTATTCAATGAACTTGTTGATCGTGTTAGCTTGGATG
GAAAATTTCTCCAACAATCCCTCTCCAAAACTAAGAAAGCAGATGAATTTACCTCTAGAC
TTTTAGATATTCATGCCAAAATGCTTGAAATGAACAAAAAAGAGGAAATACGGATGGGAT
TATTTCGTTCAGATTACATGCTTGATGAAAAGACTAAGTCACTTTTGCAAATTGAGATGA
ACACTATTTCCACTTCATTTTCTGGTGTTGGTGTTGTTATGACTGAACTTCACAGGAACA
TACTTTCTCACTATGGAAAATTGCTTGGACTAGATTCCGAAAGGGTTCCTGTCAATACTG
CCGACAGTCGGTATGCGGAGGCATTAGCTAAAGCTTGGAAGGAGTATAATAACCCTAGGG
CTGTGATTATCGTTGTGGTTCAGGGTGAAGAACGAAACATGTATGACCAGCATTTTGTGT
CTGCAATTCTAAGAGAAAAGCATCATATTACAACCATACGGAAAACATTGGCAGAAATTA
ATCAAGAAGGAGAAATTCTGCCAGATGGAACACTTTCTGTGGATGGACAAGCAGTCGCAA
TCGTTTACTTCCGAGCTGGCTATACACCAGTTGACTATCCTTCGGAATCAGAATGGAGAG
CTAGGCTACTCATAGAACAATCTTCTGCTATCAAATGCCCTAACATATCTTATCATTTGG
TTGGCACAAAAAAGATTCAACAGGAACTGGCAAGGCCCAATGTTCTTGAAAGGTTCTTTG
AAAACAAAGAGGATATTGCAAAACTGCGTAAATGCTTTGCAGGGTTGTGGAGTTTGGAGG
ATTCAGATATTGTTAATGAAGCGATTGCGAAGCCAGAGTTATTTGTGATGAAACCCCAAA
GAGAAGGAGGAGGAAACAATATTTATGGCGATGATCTTAGGGAGACCCTTAAAAGATTAC
AGAAACCAGGTTCTCAAGAAGATGCCGCTTACATACTTATGCAGAGGATATTTCCAGCTA
ACACGGCGTCAATTTTGATGCGTAATGGCTTCTTGCATAAAGATCATGTCATTTCAGAAT
TTGGGATATTCAGTACTTATTTAAGGAATAAGGATAAGGTTATTGTGAATAATGAAAGTG
GCTATATGGTACGTACAAAACCATCATTATCTGATGAAGGTGGGGTTTTGCCTGGTTTTG
GAGTAATAGATAGTGTATACCTCACATGATGAAACCAACTCATTGAATTAAAGAGGAGAA
ACTACATTGTTTCTTTTACTTTCTCCCATGACATGTTTACAATCTGTTTCTTCTACTCGA
AGAGACAGCGACCTGCTTGATTCTACCAATAAAAGATTGATGAACTGGTGTTACCTGTTT
GTTCATCTGATGTAAAGACTTTTAAGTTCTAATCTTAGCATTTCTTATGCTACGATTAGC
TTGTTAAAAAAATTGTTGGAAAGTTTGTTTATTAGACATTTTACTTGGACCCAACACATT
TCATGAGAAAAAATACAAAAGGGTGTTGCCAACTTCT
EST members of Unigene AF075700  BE320145  BE320529  AW560241  BF648233  BF647556  BF643461  EV260464  EV256417  AW685130  AW287952  BG588528  BE240751  BE239485  AJ845612  CA858083  AL366706  AL366705  BE942253  EY473959 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K01920 glutathione synthase
EC 6.3.2.3 
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.37763.1.S1_at
Corresponding NCBI Gene 832797 
Trichome-related Gene from Literature 832797