Detail of EST/Unigene TCMT47241
Acc. TCMT47241
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Pyrophosphate-energized membrane proton pump 2 OS=Arabidopsis thaliana E-value=0; Pyrophosphate-energized membrane proton pump 3 OS=Arabidopsis thaliana E-value=0; K(+)-insensitive pyrophosphate-energized proton pump OS=Moorella thermoacetica (strain ATCC 39073) E-value=0; K(+)-insensitive pyrophosphate-energized proton pump OS=Thermoanaerobacter tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) E-value=0; K(+)-insensitive pyrophosphate-energized proton pump OS=Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88) E-value=0;
Length 2155 nt
Species Medicago truncatula
Belonged EST Libraries MtBC_GLOMUS (3 ESTs); MT_CDS (2 ESTs); MT_GSEED (1 ESTs); MtSNF (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_JCVI-MT3 (1 ESTs);
Sequence GCATACATCACTGTAGCTTCCTTTCCTTTTAGGTGCCCTTTGTTCAGGTTTTGCTGGATA
TGTAGGGATGTGGGTGTCAGTTCGTGCCAATGTCAGAGTCTCTAGTGCTGCAAGACGCTC
TTCAAGAGAGGCATTGCAGATAGCTACTCGAGCAGGTGGTTTATCAGCTCTTATTGTAGT
TGGTATGGCTGTAATTGGTATAGCAGTCCTTTATGCCACATTTTATGTTTGGCTGGGAGT
GGGCACACCTGGTTCAATGAAGGTCACTGATTTGCCTCTTCTCCTAGTTGGATATGGATT
TGGTGCCTCCTTTGTCGCACTGTTTGCTCAGTTGGGTGGTGGAATATATACTAAAGCAGC
TGATGTTGGGGCAGACCTTGTTGGAAAAGTAGAACAGGGAATACCTTGAAGATGATCCTA
GAAACCCTGCTGTTATTGCTGACCTGGTTGGAGACAATGTGGGAGATTGTGCTGCTAGAG
GTGCTGATCTTTTTGAAAGCATCGCAGCTGAAATAATCAGTGCCATGATACTAGGGGGAA
CAATGGCACAACGCTGTAAAATTGAAGATCCATCTGGCTTCATCTTGTTTCCTCTTGTTG
TTCACTCATTTGATCTGGTAGTTTCATCTGTGGGAATATTTTCTATTCGGGGTACACGTG
AATCTGGAGTAATGACTCCTACTGAAGATCCTATGGCAATTCTTCAGAAAGGATATTCTG
TTACAATAGTTTTAGCTGTTCTGGCATTTGGTCTGTCTACCCGGTGGTTACTTTATGTTG
AGCAAGCACCTTCAGCATGGTTCAATTTTGCTTTGTGCGGGTTGATTGGTATTATCACAG
CGTACATTTTTGTCTGGATCACCAAGTATTATACTGACTACAAGCATGAGCCTGTGCGCA
CATTAGCCCTTTCTAGCTCTACTGGCCATGGGACTAACATAATTGCTGGAGTTAGTTTGG
GGCTGGAATCTACTGGTCTTCCAGTCCTTGTCATCAGTGTGGCGATTGTCTCAGCCTACT
GGCTGGGCCAGACTGCTGGACTAATAGATGAAACAGGAAACCCAACTGGTGGGCTGTTTG
GCACAGCTGTAGCAACAATGGGAATGCTTAGCACTGCTGCTTATATTCTTACCATGGATA
TGTTTGGCCCGATAGCTGATAATGCTGGAGGAATTGTAGAAATGAGTCAGCAGCCTGAAA
GTGTCCGAGAGATCACTGATGTCCTTGATGCCGTGGGTAACACAACCAAAGCCACCACCA
AAGGATTTGCCATTGGTTCTGCTGCGCTTGCCTCTTTCCTTCTGTTTAGTGCTTACATGG
ATGAGGTTTCTTCATTTTCTCGTGAACCTTTTAAACAGGTTGATATTGCCATTCCAGAAG
TTTTCGTTGGTGGGTTGCTGGGTGCCATGCTTATATTTGTCTTTAGTGCTTGGGCTTGTG
CTGCTGTTGGCCGAACTGCACAGGAGGTTGTTAATGAAGTAAGAAGGCAGTTCATTGAGA
GGCCTGGTATAATGGATTACAAGGAAAAACCGGATTATGCTCGCTGTGTTGCAATTGTAG
CATCCGCATCATTAAGAGAGATGATAAAACCTGGTGCTTTGGCAATCATTTCACCTATTG
TAGTTGGTTTTGTATTCCGAATTTTGGGTTACTATACAGGGCAACCCTTACTCGGGGCTA
AAGTTGTGGCTGCTTTGCTGATGTTTGCAACAGTGTCTGGTATTCTTATGGCACTTTTTC
TGAACACTGCTGGTGGTGCCTGGGATAATGCAAAGAAGTACATAGAGACCGGAGCTCTTG
GAGGCAAGGGAAGTGATGCTCATAAAGCAGCAATAACAGGAGATACAGTGGGAGACCCAT
TCAAAGACACTGCTGGTCCTTCACTTCATGTCCTTATAAAGATGCTCTCAACGATTACAT
TGGTAATGGCTCCCATCTTCCTGTGAGAGTTGTTGATATCTCTATTGCGGCCTCTAAAAA
GCATACTTTTGCCTATTTGATTTTGATATTTTTGGGAGTATAGAGATAGGTTGTATGAAT
CTAAAATGTACATCGACGAGCTTGATTTATAGTGACATTGAATTTTCTTGTTCTTGATCA
GAATAAGAGATGTTAGTTGACCCAACAAATGGCAAATATAGGAAATGTCCTCCAT
EST members of Unigene BT052960  BT051081  AL386452  AL386451  AL386220  CX537520  AJ845678  BE205327  EY475534 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase
Probeset Mtr.4474.1.S1_at, Mtr.9252.1.S1_at
Corresponding NCBI Gene 844231 
Trichome-related Gene from Literature 844231