Detail of EST/Unigene TCMT46350
Acc. TCMT46350
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FtsH OS=Guillardia theta E-value=0;
Length 1583 nt
Species Medicago truncatula
Belonged EST Libraries MT_INSECT (19 ESTs); MT_LEAF_PHOMA (9 ESTs); MT_Shoots (7 ESTs); MT_PhoLEAF (6 ESTs); MT_DSTEM2 (4 ESTs); MT_GPOD (2 ESTs); MtBA (2 ESTs); MT_Drought (2 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DSLC (1 ESTs);
Sequence CCTCTAGCCACACCCAATCCTTCATAAATCCACTTGTTGCTAACTCCAACTCTTCTTCAT
CATCACCTTCCTCTGCACTCAGAGGTTCAAACCTTCCACACATTCCTCTCTCACTTTTTA
CTTTTAAGATGGCAGCATCATCAGCATGTCTTGTTGGTAATGCTTTATCCACAAACAGTA
ATAGAACTACTCTTGGTAAAGATTTGAATGGTAGATATCTCTTTTCATCATGGAGATTTT
CATCCTTGAATAATAAGGCATCAAAATCATTTTCCATAAAAGCATCCTTGGAACAGAATC
AGCAGGAAGGAAGAAGGGGGATTCTGAAATTGTTGCTTGGAAATGTCGGTGTTGGTTTGC
CGGCATTATTGGGAAATGGAACAGCTTATGCTGCTGATGAACAAGGGTCATCCTCCAGAA
TGTCGTATTCGAGGTTTCTTGAGTATTTGGATAAGGATAGAGTTACCAAAGTTGATCTAT
ATGAGAATGGAACCATAGCTATTGTTGAGGCCGTGTCTCCTGAATTGGGAAATAGGTTGC
AGCGTGTTCGAGTTCAACTTCCTGGACTTAGCCAAGAGCTTCTTCAGAAATTCAGGGAAA
AGAACATTGACTTTGCAGCTCATAATGCTCAAGAAGATTCGGGTTCTCTTTTGTTTAATC
TCATTGGGAATCTTGCTTTCCCTGCTGCTGTCATTGGTGTATTGTTTCTTCTCTCGAGGC
GGTCCGGTGGAATGGGAGGTCCCGGTGGACCTGGATTTCCTATGCAATTTGGCCAATCTA
AAGCCAAGTTTCAAATGGAACCAAACACTGGAGTGACTTTTGATGATGTTGCTGGGGTGG
ATGAAGCCAAGCAGGATTTTATGGAGGTGGTTGAATTTCTCAAGAAGCCTGAGAGGTTCA
CTTCTGTTGGTGCTCGCATTCCGAAAGGAGTTCTTCTTGTTGGTCCTCCAGGAACTGGAA
AGACTTTGTTAGCCAAGGCTATTGCTGGTGAAGCTGGTGTTCCGTTTTTCTCTATATCAG
GTTCTGAGTTTGTTGAGATGTTTGTTGGTATTGGTGCTTCTCGTGTCCGTGACTTGTTCA
AGAAGGCTAAAGAGAATGCTCCTTGCATTGTCTTTGTTGATGAAATTGACGCTGTTGGAA
GACAAAGAGGGACTGGAATTGGTGGAGGGAATGACGAAAGAGAACAGACCCTCAACCAAC
TTTTGACAGAAATGGACGGATTTGAGGGTAATACCGGTGTCATTGTTGTTGCTGCAACTA
ACAGGGCCGACATTCTTGACTCTGCGTTATTGAGACCAGGCCGATTTGATAGACAGGTAT
CGGTTGATGTTCCAGATGTAAGGGGAAGGACCGAAATCCTAAAGGTTCATGCTAACAATA
AAAAATTTGATAATGATGTTTCTCTTGAAGTGATTGCAATGAAAACACCTGGTTTCAGTG
GAGCTGATCTTGCAAATCTATTGAATGAAGCTGCTATATTANCTGGTCCGGCGAGGAAAG
ACANGGATTTCACCTAAAGANATTGACCATTCTATTGATANGATTGTCCCTGGAATGGAA
NGAACATTAATGACCGATGGGAA
EST members of Unigene CX528077  CX527237  CX526944  CX526563  CX526024  CX525737  CX525335  BG447628  AW691449  AW691578  AW688992  DW019146  BF005043  BI272764  BQ141439  BQ141019  BQ140946  BQ140179  BQ139974  BQ139653  BQ139489  BQ139266  BQ137955  AW683545  BI309488  BI309473  BI264336  BI263436  BG457186  BG456308  BG456060  BG455330  CX531613  AL369063  AL366818  BG450217  BF632579  BI268218  BI267995  BI267490  BI266733  BI266166  BI265393  BG448996  BG448872  BE322019  BE321107  BE322714  BE321508  BF642309  BF641983  BF641740  BF641328  BF640206  BF639775  BF639420 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.- 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817646 
Trichome-related Gene from Literature 817646