Detail of EST/Unigene TCMT46349
Acc. TCMT46349
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=0;
Length 1506 nt
Species Medicago truncatula
Belonged EST Libraries MT_VILEAF (9 ESTs); MT_DSIL (3 ESTs); MtBA (3 ESTs); MT_INSECT (3 ESTs); MT_DFLOWER (2 ESTs); MT_PhoLEAF (2 ESTs); MtBB_NOD (2 ESTs); MT_GESD (2 ESTs); MT_HOGA (1 ESTs); MT_Drought (1 ESTs); MT_GSEED (1 ESTs); MT_JCVI-MT1 (1 ESTs);
Sequence GTAATTGGTGGAGGGAATGACGAAAGAGAACAGACCCTCAACCAACTTTTGACAGAAATG
GACGGATTTGAAGGTAATACCGGTGTCATTGTTGTTGCTGCAACTAACAGGGCCGACATT
CTTGACTCTGCGTTATTGAGACCAGGCCGATTTGATAGACAGGTATCGGTTGATGTTCCA
GATGTAAGGGGAAGGACCGAAATCCTAAAGGTTCATGCTAACAATAAAAAATTTGATAAT
GATGTTTCTCTTGAAGTGATTGCAATGAGAACACCTGGTTTCAGTGGAGCTGATCTTGCA
AATCTATTGAATGAAGCTGCTATATTAGCTGGTCGGCGAGGAAGGACAGGGATTTCACCT
AAAGAGATTGACGATTCTATTGATAGGATTGTCGCTGGAATGGAAGGAACATTAATGACC
GATGGGAAGAGCAAAAGTTTAGTGGCATATCATGAAGTTGGGCATGCCATTTGTGGAACT
TTGACTCCTGGTCATGATGCGGTACAAAAGGTGACATTAGTTCCTCGAGGTCAAGCTCGG
GGTCTTACATGGTTCATTCCTTCCGATGACCCAACTCTGATCTCAAAACAACAACTCTTT
GCAAGAATTGTTGGAGGATTAGGTGGTAGGGCTGCAGAAGAAATTATTTTTGGTGAGCCT
GAGGTTACAACTGGTGCAGGTGGTGATTTGCAGCAAATCACCGGTATAGCAAGACAGATG
GTAGTCACATTTGGAATGTCTGATATTGGTCCTTGGTCACTTATGGACTCGTCAGCGCAA
AGTGGCGATGTTATCATGAGAATGATGGCAAGGAACTCAATGTCAGAAAAGCTTGCAGAA
GATATTGATACCGCTGTCAAGAGATTGTCAGATGAAGCATATGAAATTGCATTGACACAG
ATAAGGAACAACCGTGAGGCAATTGATAAGATTGTGGAAGTCCTTCTGGAGAAGGAGACA
TTGAGTGGAGATGAATTCCGCGCTCTACTGTCAGAGTTTACTGAAATTCCAGTTGAAAAT
CGGGTTCCTCCTTCAACTCCAGTAGCAGTCCCAGTTTGAATGGCCTGTATGTAGTTATTT
AAAAATGTATGTATCATCTCAGAATACGAAGTTACCGTCTCCATTATGCTTCAAATTTGT
GCATGACAAGCTTCTATCTTACATTTTAATTGTTATAGTGTTGATAGTGACAACATACAA
TATATACAAATAGTACATATTTGATTGCAGAAATCCATAATTTGTTCCAACACATCTATT
ATAATGTATAATTTGTTGCGAGTAACAACTAACAAGCCATTAATCGCAACTGGTCAATAG
GAATGGGAATAGGCGAGATGACTTACAGAAGCTTATGGCATAGCCTACCTCAAGCTGAAG
TTAAGCCAAAACTTTTTAGAAGTCTCTTTAACCAAGATGGCTATGTTTTAAGTAATTTGG
AATGTCTTTTAGCCTACCAGACCGGTCTATTTAGTTAATAAAAACATTTTTTTTTTTGCC
ATCGTT
EST members of Unigene AL374802  AL374801  CX539642  EV257695  CA991133  CA990701  BI271681  BI271331  BF520229  BF518754  AW776079  BI263543  BG457747  CX521304  CX520883  CX520165  CX519988  CX519684  CX519582  CX518436  CX518271  CX516836  CB892722  AL369064  AL366819  AL366742  BF631969  BI266596  BE321540  BE321448 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.-  3.6.1.3 
Transcription Factor Family
Transporter Classification Family
Probeset Msa.1716.1.S1_at, Mtr.40184.1.S1_at
Corresponding NCBI Gene 817646 
Trichome-related Gene from Literature 817646