Detail of EST/Unigene TCMT44242
Acc. TCMT44242
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 1174 nt
Species Medicago truncatula
Belonged EST Libraries MT_DLEAF (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_PhoLEAF (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DFLOWER (1 ESTs);
Sequence CTAACCTCAGTAACGAACCTCACTACTACAAATACGAACCTAATTCATTCTTTTCAAATC
CTCTCAGAATTTCCTCATTCTCTAGTTTCTCACTCTTCTTTCTCTCTCTCTTCGCCGTTC
ATACTATGCCGGAAGCACGAGACCGCCGCGTCATTCCTCTTGACGTGGATACTCTATTCC
GACGACCTTTCTCCGCCGTGTTTCAAGAATCTGAGCCACTCTCCGTTACACCCGCACCTG
CTCCATTCACCGCCGGTTTAGATCTGTTCTTCACTGAAAGAACTCCCGTACGTCGCGAAG
TTGCTCGTGCGCGTCGTTCTCCAGGTTCGGAAAATACTCCTCCGACCACTGCTCGCCGTG
GAAGAGGCCGTGCTACTGCATCGAGGAGTGCACTTCCGTCTTGGTACCCGAGGACGCCGT
TGCAGGATATCACTGCTATTGTTCGAGCGATTGAGAGAAGGAGGGAGAGACAGGGAACTG
AGGAAATTGAGCAAACTGGAACACCAGTTCATGCTAACCAGCTGACCATTTTCTCTGATC
CATCTTCATTCTCTGCTGCTATTGGATCTTCTTCACGCGTCCACAAAAAATTCACCAAAA
TCCTGCATCAAGCTGAAAACACCTTATGGAAGTAAAGTTCCAAAAATCATCATTGACATT
GCAAAACTTCCTGCTGCTGAAGATGGTGAATCTGAGCTTCTGACTCCTCAGAAGAAGCTA
TTGCATTCGATTGATATAATTGAGCGTGAAGTGAAGCAAGAGTTGATGAAACTCAAGAGA
ACCCCTACAGCCAAAAAAGCAGAACATCAGAAAAGGGTTAGGACCTTGATGTCCATGAGG
TGAATTGAAGAAGATTTAAAGTGCAGGAAAAAATTAAAGAGAATTGAAGGAGAAATCTTA
GAGCAAATGGGAAAGGAGATTTGGGCTGAGCTTAATCATCTTCTGATGATTTATAGGGCT
TCAAGAAGGAAAGCAGAGAACTTGGTGTTTGATCCAGTTTGTGTAATCTTCTACTTGAAG
ATTATAGCTGTATACATTTTAGATTTTTCCGTGCATCATCATTCTTTGATGATTTTGTTG
CAATTTTGGTGTAATCCATTGTATATATTACAATGTATGACTATAGTTTTGAATCGAATG
ACACCTATTTCTTTTCTCTTAATCAAATTGTTTG
EST members of Unigene CA922504  AW686686  CB891577  BQ148682  BG452444  AW257304  BF639140 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.17492.1.S1_at
Corresponding NCBI Gene 818827 
Trichome-related Gene from Literature 818827