Detail of EST/Unigene TCMT43896
Acc. TCMT43896
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Tubulin-specific chaperone A OS=Arabidopsis thaliana E-value=6e-44; Tubulin-specific chaperone A OS=Homo sapiens E-value=1e-17; Tubulin-specific chaperone A OS=Rattus norvegicus E-value=7e-17; Tubulin-specific chaperone A OS=Oryctolagus cuniculus E-value=2e-16; Tubulin-specific chaperone A OS=Mus musculus E-value=2e-16;
Length 716 nt
Species Medicago truncatula
Belonged EST Libraries MT_JCVI-MT2 (4 ESTs); MtBB_NOD (2 ESTs); MtBC_GLOMUS (1 ESTs); MT_ECELL (1 ESTs); MTAMP (1 ESTs); MT_PhoLEAF (1 ESTs); MT_JCVI-MT3 (1 ESTs);
Sequence GCTTCTGAAATAGAATCACTGCGCTCATTTCGTGATTTTCTTCTCTGTTCAAGTCACAGC
AATTTCAACATTCCAGTTTTCCCCATCTCAATTGGCCAAACGCAAGGTTGCTGGGTATCC
CACCGTGTAAACAAAAACACATGCTTAATGGTAGAGTAGAGGACTCTGCCTGATCCTTAT
CTTAGAGAATAGATTGAAAACAAAGGAATTCAATGGATACTGTAAGAAGCCTGAAAATCA
AGACGAGTACCTGCAAACGACTTGTGAAGGAGCTGCATTCTTATGAAAAGGAAGTTGAGA
GAGAAGCTGCCAAAACAGCTGATATGAAGAACAAAGGAGCTGACCCTTATGATCTCAAGC
AGCAGGAAAATGTGCTGGGTGAGTCAAGGATGATGATTCCTGACTGCCGCAAGCGTTTGG
AGGCCGCTTTGGAAGACTTGAAAGGAATATTGGCCGAGTTGTTGAATGAGACTGATAAAA
AGGAAAGCCCTGAAATTGATGAAGCTCGAAACACCATTGTGGAAGTTGAAAAGGTATTTG
AAACAATTGAAGCTTAGGAAGGCAGTTACACCAGTGTATGCGGTGGACGATATTGTGCCT
GTATTATATAGTTTCTCCTTGATCTTCAAAATTTGATCGATGCTGAAAAAGTTTATGAAA
CTTGTGACATTTAACCTTATATATACTTAAGTATGACATCGATTTACTTTTCTAAA
EST members of Unigene AL383863  AL379442  AL379441  BG448356  AJ503939  BG457728  EY474828  GE352749  GE348483  GE349327  GE344224 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.41426.1.S1_at
Corresponding NCBI Gene 817592 
Trichome-related Gene from Literature 817592