Detail of EST/Unigene TCMT42139
Acc. TCMT42139
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=0; Probable mannitol dehydrogenase 3 OS=Stylosanthes humilis E-value=0;
Length 1322 nt
Species Medicago truncatula
Belonged EST Libraries MT_JCVI-MT1 (2 ESTs); MT_DSIL (2 ESTs); MT_VILEAF (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs);
Sequence GGAATTATCATAACATAGTTTGAAATGGCAACAGAAGGTAAAGTAGTAGAGCATCCTAAG
AAGGCCTTTGGATGGGCAGCTAGAGATCCTTCTGGTGTTCTCTCCCCATTCAATTTCTCT
AGAAGGGAAACTGGTGAAAAAGATGTAGCATTCAAGGTGTTGTATTGTGGGATATGTCAC
TCTGATCTCCATATGGCTAAGAATGAATGGGGCACTTCCTTCTATCCACTTGTTCCTGGG
CATGAGCTTGCGGGTATAGTAACAGAAGTAGGAAGCAAAGTGGAGAAGTTTAAAGTTGGA
GACAAAGTAGGTGTTGGCTACTTGATTGATTCATGTCGATCATGCCAAGATTGTAATGAC
AATCTTGAGAATTACTGCCCCAAATTTGTAGTCACATGTGGTGCCAAGTATCGTGATGGA
ACCGTCACTTATGGAGGTTACTCCGACTCAATGGTTGCAGACGAGCACTTTGTGATTCGC
ATTCCTGACAACATACCTCTTGAATTTGCTGGTCCTCTCCTTTGTGCTGGTGTCACCGTA
TATAGTCCTCTTCGATTTTTTGGACTCGATAAGCCTGGTTTACATATAGGTGTTGTTGGT
CTTGGTGGACTTGGCCATATGGCTGTGAAATTTGCCAAAGCTTTCGGTGCTAATGTTACC
GTAATTAGTACATCGCCTAACAAAGAAAAGGAAGCAATAGAACACTTAGGAGCTGATTCA
TTTCTGATAAGTAGTGACCCAAAGCAGATTCAGGGTGCAATTGGTACTTTGGATGGTATT
ATTGACACAGTTTCAGCTGTTCATCCTCTCTTACCAATGATTGGTCTCTTGAAGTCTCAT
GGAAAGCTTATAATGCTTGGTGTAATAGTACAGCCTTTGCAGCTTCCTGAATATACGTTA
ATTCAAGGGAGAAAAATATTAGCTGGAAGTCAAGTTGGAGGGTTAAAGGAGACTCAAGAA
ATGATTAATTTTGCGGCAGAACACAATGTAAAGCCGGATATCGAGGTTGTTCCGATTGAT
TATGTCAACACAGCAATGCAGCGTCTTGCTAAGGGAGACGTGAAATATCGATTTGTGATT
GATATTGGAAACACACTGAAACCAAGCTCTTGAACTTTGCAGGATACATTAGCATGATTC
ACGGGTTAACAAATAATTTAACAAAAACATGAGCTTAAGTGTATCACTTGCCAAGGATAA
TTTAGATTTCCATCGTTATTGTAATGTTGTTATGCAATTTTCTATGTCCTGTGCTTAATG
TTAATCATGCTATTTTTAATAAAAAATTCTTTTGCTTTTAACAAAAAAAAAAAAAAAAAA
AA
EST members of Unigene BT052068  CF067998  EV257932  EV256381  DW018280  BQ146448  BE249382  AW981393  AW776209  CX522803  CX522780 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase;
Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase;
Metabolism > Metabolism of Cofactors and Vitamins > ko00830
EC 1.1.1.1 
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.38474.1.S1_at
Corresponding NCBI Gene 829954 
Trichome-related Gene from Literature 829954