Detail of EST/Unigene TCMT41355
Acc. TCMT41355
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) DELLA protein GAI OS=Solanum lycopersicum E-value=1e-89; DELLA protein GAI1 OS=Vitis vinifera E-value=1e-87; DELLA protein GAI OS=Gossypium hirsutum E-value=6e-84; DELLA protein GAIP OS=Cucurbita maxima E-value=2e-82; DELLA protein GAIP-B OS=Cucurbita maxima E-value=8e-82;
Length 992 nt
Species Medicago truncatula
Belonged EST Libraries MT_KVKC (3 ESTs); MtBB_NOD (2 ESTs); MT_TRI (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_SROOT_KV2 (1 ESTs); GLSD (1 ESTs); MT_PhoLEAF (1 ESTs); MT_VILEAF (1 ESTs);
Sequence GGACCGCCGCAGGCGGACTTACTGATGCTTTGCAACAAGTTGGCTGGAAATTAGCTCAGC
TTGCTCAGACAATCGGTGTTCAGTTCGAATTTCGTGGATTTGTTTGTAACAGTATTGCGG
ATCTTGACCCGAATATGCTTGAGATCCGACCCGGTGAAGCTGTTGCTGTTAACTCCGTTT
TCGAGCTTCATACCATGTTAGCTCGACCCGGTTCAGTTGAGAAAGTTCTCAACACTGTTA
AGAAGATAAACCCTAAAATCGTAACAATCGTTGAGCAAGAAGCGAATCATAACGGACCGG
TTTTCGTAGACCGGTTTACCGAAGCTTTACATTATTACTCAAGCTTATTCGATTCACTGG
AGGGTTCGAATTCGAGTTCGAATAATTCCAACTCGAACTCGACCGGGTTGGGTTCACCGA
GTCAGGATTTGTTGATGTCAGAGATTTATTTGGGAAAGCAAATATGTAACGTGGTGGCTT
ATGAAGGAGTGGACCGAGTTGAAAGACATGAGACTTTGACTCAATGGCGGTCTAGGATGG
GTTCAGCTGGGTTCGAACCGGTTCATTTGGGTTCAAATGCGTTTAAACAAGCTAGTACTT
TGTTAGCTTTGTTTGCTGGTGGTGATGGTTATAGGGTTGAGGAAAATAATGGATGTCTTA
TGTTAGGGTGGCATACAAGGTCACTCATTGCTACTTCTGCTTGGAAGCTTCCACAAAATG
AGTCCAAGTGAGTTAACTCAGGGTACCCTTAAGTCTAGGGTAAGTTGATGGGTTAATTAT
GAAAATATGACCAATTAGGGTGGTGGATTAGTTGAAAATTTCATGTTGATGAGTGAAAAG
TGAGTGAGGCAAGGGATGAGATAAATAAAGGGTAAAAAAAAAAAAAGTAAAAACAATCAA
ATTCTGTCTGTAATTTGTAATTGTAATGTTAATTTCGATTTTATTTTATTTTAGTGTTTT
TTATTTTTTTGCTTTAAGTTAAATAATTTTTT
EST members of Unigene CA920462  AL383760  AL381121  AL374024  AI974628  BQ124572  BF638115  CX518411  BQ165355  BQ164917  BQ164916  EX532425 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family GRAS
Transporter Classification Family
Probeset Mtr.31658.1.S1_s_at, Mtr.37355.1.S1_at
Corresponding NCBI Gene 814686 
Trichome-related Gene from Literature 814686