Detail of EST/Unigene TCMT41013
Acc. TCMT41013
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=0; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=0;
Length 1444 nt
Species Medicago truncatula
Belonged EST Libraries MT_DSIL (10 ESTs); MT_PhoLEAF (4 ESTs); MT_INSECT (4 ESTs); MT_Shoots (2 ESTs); MT_VILEAF (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_GPOD (1 ESTs); MT_CDS (1 ESTs); MTUS_MIXTISSUE (1 ESTs);
Sequence TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG
GTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGAATAGATGCTACTAAATTAGTA
GTGTTTCCTAAGAAGGCCTTTGGATGGGCAGCTAGAGACTCTTCTGGTGTTCTATCCCCT
TTCCATTTCTTTAGAAGGGAAACGGGTGAGAAAGATGTAGCATTCAAGGTGTTATATTGT
GGGATATGTCACTCTGACCTTCACATTATGCAGAATGAATGGGGCAAAACCACCTATCCA
TTAGTCCCGGGGCACGAACTTACGGGTGTAGTAACAGAGGTGGGAAGCAAAGTAAAAAAG
TTTAAAGTTGGAGACAAAGTAGGGGTGGGATACATGGTTGATTCATGTCGTTCTTGCGAA
AATTGTGCCGACGATATTGAGAATTACTGCACCAAATATACTCAAACATTCAATGGTAAG
TCTCGTGATGGCACTATCACCTATGGAGGTTTCTCCGACTCAATGGTTGCAGACGAGCAC
TTTGTGATTCGCATTCCTGATAGCTTACCTCTTGATGGTGCCGGTCCTCTTCTTTGCGCT
GGAGTCACAGTGTATAGTCCTCTTCGACATTTTGGACTCGACAAGCCTGGTATGAATATA
GGAGTTGTTGGTCTTGGTGGACTTGGTCATATGGCTGTGAAATTTGCTAAAGCTTTTGGT
GCTAAAGTGACCGTAATTAGTACGTCGCCTAAAAAGGAAAAGGAAGCAATAGAACACTTA
GGAGCAGACTCGTTTCTAGTAAGCCGCGATCCAGAACAGATGCAGGCTGCAACGAGTACT
TTGAATGGCATTATTGACACAGTTTCGGCGAGTCATCCTGTTGTACCATTGATTGGTTTA
TTGAAATCTAATGGAAAGCTGGTAATGGTTGGTGCAGTAGCAAAGCCTCTAGAACTTCCT
ATATTTTCTTTACTTGGAGGGAGAAAGTCAATAGCTGGAAGTTTAATTGGAGGGATAAAA
GAGACTCAAGAAATGATTGATTTTGCTGCTAAACACAATGTAACGCCTGAGATTGAGGTT
GTTCCTATTGATTATGTCAACACCGCAATGGAGCGTCTTGTTAAAGGAGATGTCAAATAT
CGATTCGTGATTGATATTGGAAATTCACTAAAACCAAGCCCTTAAACATTGCAGGATATA
TATTCTCAGAATGATTCATAGATAAACAAATAATAATAAAAACGTATAGTTTAAGTGTAT
CACGCACTTGCCAATGGTATTTTAGATTTCCCTCTGTTGTATTTGTGTGATGTAATTTTT
CTAGTGCATAAAAAAAAAATAAGCATCGAGTGCATTATGATAAAAATCTATGTTTTGTAC
TTATGGTGAATCATGTTATTTTTAACAAAAATTTGTTTGCATCCTAAATATAATAGCGTT
AGAG
EST members of Unigene BT051572  CA918767  CX526602  CX524886  AW697220  EV254863  DW017235  CA917614  BF521442  BF520456  BF520453  BF519575  BE124289  BE123884  AW981344  AW981208  AW776649  AW776308  BE324445  BE325022  BF638191  BF638114  CX519139  CX518212  BI266731  BI265866  BF639755  BF639373  GE349253  GE344147 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase;
Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase;
Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase;
Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase;
Metabolism > Metabolism of Cofactors and Vitamins > ko00830
EC 1.1.1.1 
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.37342.1.S1_at
Corresponding NCBI Gene 829954 
Trichome-related Gene from Literature 829954