Detail of EST/Unigene TCMT40730
Acc. TCMT40730
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) DELLA protein GAI OS=Solanum lycopersicum E-value=0; DELLA protein GAI OS=Gossypium hirsutum E-value=0; DELLA protein GAI1 OS=Vitis vinifera E-value=0; DELLA protein GAIP OS=Cucurbita maxima E-value=0; DELLA protein GAIP-B OS=Cucurbita maxima E-value=0;
Length 2022 nt
Species Medicago truncatula
Belonged EST Libraries MT_DSTEM2 (7 ESTs); MT_Shoots (6 ESTs); MtBA (3 ESTs); MT_GPOD (2 ESTs); MtRHE (2 ESTs); MT_IROOT_DSIR (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_HOGA (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_KVKC (1 ESTs); MT_GSEED (1 ESTs);
Sequence CCTCCTTTCTCTTGTCTCAACCCCTTTTCTCCCATTCTTCTAAACTTCAAACCATAAACT
CAAAAAACCCCATTTTGCTATGACCCAACTCAAATTCTAAATCAAAATCTATTCACTTCA
CCAATTTAATCAACAAATTATAGAAAGAAAAAAAAAATGAAGAGAGAACACCAAGAAAGT
TTTGGTGGGGGTGTGATTAGCAACAACAACAAAACAAACACCAACCACCTTAACAGCAGC
AAAAACATCAACTTTGGTGAATGTTCATCAATGCAAAACACAAACACAAAACAAAACATG
TGGAGAGAAGAAAAAGAAACCAACGGTGGTGGAATGGACGAGTTGTTAGCAGCATTAGGT
TACAAGGTTCGCTCTTCCGACATGGCTGATGTAGCTCAAAAGCTTGAACAGCTTGAGATG
GTTATGGGTAGTGCTCAAGAAGAAGGTATCAATCATCTTTCTTCTGATACTGTTCACTAT
GACCCAACCGATCTATATTCATGGGTTCAAACCATGCTCACTGAACTCAACCCTGATTCT
TCTCAAATCAACGACCCTTTGGCTTCTTTGGGTTCTTCTTCTGAAATCCTCAACAACACT
TTCAATGATGATTCTGAGTATGATCTTAGCGCTATTCCTGGAATGGCAGCATACCCACCT
CAAGAAGAAAACACAGCTGCTAAACGAATGAAGACTTGGTCTGAACCAGAATCTGAACCG
GCGGTAGTGATGTCACCACCGCCGGCGGTGGAAAATACAAGACCGGTGGTTCTTGTTGAC
ACACAAGAAACTGGTGTTCGTCTTGTTCATACTTTAATGGCTTGTGCAGAAGCGATTCAG
CAAAAGAATCTGAAACTTGCAGAAGCGCTTGTGAAGCATATAAGCTTATTAGCTTCGTTA
CAAACCGGTGCGATGAGAAAAGTTGCTTCCTATTTCGCACAAGCACTTGCAAGAAGAATC
TACGGTAACCCAGAAGAAACAATCGATTCATCATTCTCAGAAATTCTTCACATGCACTTC
TATGAATCTTCACCTTATCTCAAATTCGCTCATTTCACTGCTAATCAAGCTATTCTCGAA
GCTTTCGCCGGTGCCGGAAGAGTTCATGTTATAGATTTTGGTCTTAAACAAGGGATGCAA
TGGCCTGCGCTTATGCAAGCGCTGGCATTACGTCCTGGCGGTCCTCCTACGTTCCGGTTA
ACCGGCATCGGACCGCCGCAGGCGGACAATACTGATGCTTTGCAACAAGTTGGCTGGAAA
TTAGCTCAGCTTGCTCAGACAATCGGTGTTCAGTTCGAATTTCGTGGATTTGTTTGTAAC
AGTATTGCGGATCTTGACCCGAATATGCTTGAGATCCGACCCGGTGAAGCTGTTGCTGTT
AACTCCGTTTTCGAGCTTCATACCATGTTAGCTCGACCCGGTTCAGTTGAGAAAGTTCTC
AACACTGTTAAGAAGATAAACCCTAAAATCGTAACAATCGTTGAGCAAGAAGCGAATCAT
AACGGACCGGTTTTCGTAGACCGGTTTACCGAAGCTTTACATTATTACTCAAGCTTATTC
GATTCACTGGAGGGTTCGAATTCGAGTTCGAATAATTCCAACTCGAACTCGACCGGGTTG
GGTTCACCGAGTCAGGATTTGGTGATGTCAGAGATTTATTTGGGAAAGCAAATATGTAAC
GTGGTGGCTTATGAAGGAGTGGACCGAGTTGAAAGACATGAGACTTTGACTCAATGGCGG
TCTAGGATGGGTTCAGCTGGGTTCGAACCGGTCATTTGGGTTCAAATGCGTTTAAACAAG
CTAGTACTTTGTAGCTTTGTTGCTGGTGGCGATGGGTATAGGGTGAAAAATAATGGGATG
TCTTATGTTAGGGGGCATACAAGGGCACTCATTGCTACTTCTGCTTGGAAGCTTCCCAAA
ATGAGTCCCAGGAGTTACTCAGGGTCCCTTAGTTTAGGGAAGTTGATGGGGTAATTTTGA
AAATTGACCCATTTGGGGGGGGGGTATGGAAAATTTCTGTTG
EST members of Unigene DY617008  CX541858  AW267879  CX527122  CX526495  CX526055  CX525967  CX524024  CX524005  AW695914  AW693591  AW697326  AW696350  AW694064  AW694061  AW688657  EV260462  DW017809  AW774515  CA916938  BI308816  BG647068  AA660952  AA660201  BQ165354  AL371425  AL369482  AL369357  BE321891 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family GRAS
Transporter Classification Family
Probeset Mtr.31658.1.S1_s_at
Corresponding NCBI Gene 814686 
Trichome-related Gene from Literature 814686