Detail of EST/Unigene TCMT40320
Acc. TCMT40320
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 11 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 17 OS=Arabidopsis thaliana E-value=0;
Length 1562 nt
Species Medicago truncatula
Belonged EST Libraries MT_DSTEM2 (3 ESTs); MT_GSEED (2 ESTs); MT_Shoots (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MT_INSECT (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); MT_DSIL (1 ESTs);
Sequence TTTGATTACGCCAAGCTCGAAATTTACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCAC
CGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGG
CCTCGTGCCGAATTCGGCACGCAAAAACAACATTGTAAACACAATATTCTGCTGTTCCAA
CTATGGCTACTAACGAAGGTGACATGTTCTCAGCAGAGATTGTGAACCGTGGGATTGAAT
CATCGGGTCCGAACGCCGGTTCATTGACGTTCTCTGTCCGTGTTCGGAGACGGTTACCGG
ATTTTCTTCAATCTGTGAACCTTAAGTATGTGAAATTGGGTTACCATTATCTGATAAACC
ATGGTGTTTATTTGTTCACTATACCAATTCTACTTGTTGTGTTTAGTGCTGAGGTTGGTA
GTCTTAGCAAAGAAGATCTTTGGAAGAAGATTTGGGAAGATGCAACTTATGATCTTGCAT
CTGTTCTCTCTTCTCTTGCTGTCTTTGTTTTCACTTTCACTCTTTACTTCATGTCAAGGC
CACGTCCTATTTATCTCATTGATTTTGCATGCTATCAACCTGATGATGAACTCAAGGTAT
CTAGGGAGCAATTGATAGAGCTAGCAAGAAAATCAGGAAAATTTGATGAAGGAAGTCTAG
AATTCCAAAAGAGGATAGTAATGTCATCAGGAATAGGTGATGAAACATACATTCCAAGAT
CAGTGATATCATCAAGTGAAAACACAGCAACAATGAAAGAAGGTAGAGCTGAGGCATCAA
TGGTTATGTTTGGAGCACTTGATGAACTCTTTGAAAAAACAGGAATTAGACCAAAAGATG
TTGGTGTTCTTGTAGTAAATTGTAGCATATTCAATCCAACACCATCATTGTCAGCCATGA
TTATAAATCATTATAAGATGAGGGGAAATATTTTGAGTTATAATCTTGGTGGTATGGGTT
GTAGTGCTGGAATTATTGCTGTTGATTTGGCTAGGGATATACTTCAATCTAATCCTGGTA
ACTATGCTGTTGTTGTGAGTACCGAAATGGTTGGATTTAATTGGTATCAAGGAAAAGAAA
GATCAATGCTTATTCCAAATTGTTTCTTTCGTATGGGTTGTTCTGCTGTTTTGCTCTCTA
ACCGTCGTCGTGATTTTGGCCGCGCGAAATATCGTCTTGAACACATTGTTCGTACACATA
AAGGTGCTGATGATCGCAGTTTCAGGTGCGTGTACCAAGAGGAAGACGACCAGAAATTCA
AAGGAATAAAGATAAGCAAAGACTTAATTGAAATTGGTGGCGAAGCTCTCAAAACTAACA
TCACAACACTAGGACCATTGGTCCTACCCTTTTCAGAACAGCTTATTTTCTTTGCTACAT
TAATGTGGAGGAACTGGTTTGGTGGTGGAAAATCTGATAAAAATTCACCATCATCAAACA
AGCCATACATTCCTAACTACAAACTAGCTTTTGAGCATTTTTGTGTGCATGCTGCCAGCA
AAACCATTCTTGATGAGCTTCAAAAGAATCTTGAATTGAGTGACAAGAACATGGAAGCTT
CT
EST members of Unigene CX542052  CX539992  CX525088  CX523784  AW691344  AW690866  AW695885  EV260097  DW016163  BI273227  BQ139658  BQ138857  AW682853  BI309439  BF518713  BE322550  BE321743 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset Msa.1891.1.S1_at, Mtr.12642.1.S1_at
Corresponding NCBI Gene 817165 
Trichome-related Gene from Literature 817165