Detail of EST/Unigene TCMS40772
Acc. TCMS40772
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Trans-cinnamate 4-monooxygenase OS=Medicago sativa E-value=0; Trans-cinnamate 4-monooxygenase OS=Pisum sativum E-value=0; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=0; Trans-cinnamate 4-monooxygenase OS=Cicer arietinum E-value=0; Trans-cinnamate 4-monooxygenase OS=Vigna radiata var. radiata E-value=0;
Length 1761 nt
Species Medicago sativa
Belonged EST Libraries MS_TRI1 (3 ESTs); MS_CDS (1 ESTs); MS_TRI2 (1 ESTs);
Sequence CCCAAAACACAAACAAGAAAAAAAACACAAAAACACACACTCAACAATGGATCTTCTCCT
CCTTGAAAAGACCCTTTTAGCCCTCTTCATCGCCGCCACAATCGCCGTCACAATCTCAAA
ACTCCGTGGCAAACGCTTCAAACTCCCACCAGGTCCAATCCCAGTCCCTATCTTCGGAAA
CTGGCTTCAAGTCGGAGATGATCTCAACCACCGTAACCTCACCGATTACGCCAAACGCTT
CGGTGAAATCTTCCTCCTACGTATGGGCCAACGTAACCTAGTCGTAGTTTCTTCCCCAGA
ACTCGCCAAAGAAGTCCTCCACACACAAGGTGTTGAATTCGGATCACGTACACGTAACGT
AGTTTTCGACATCTTCACAGGTAAAGGACAAGACATGGTGTTCACTGTCTACGGCGAACA
TTGGCGTAAAATGCGTAGAATCATGACCGTTCCGTTCTTCACAAACAAGGTTGTTCAACA
GTATCGTTACGGGTGGGAGTCTGAAGCTGAGAGTGTTGTTAACGATGTTAAGAACAACGC
CGAAGCGAGTGTTGGTGGGATTGTTATAAGGAAGAGGTTACAGTTGATGATGTATAATAT
AATGTATAGGATTATGTTTGATAGAAGATTTGAGAGTGAAGAAGATCCTTTATTTGTGAA
GTTGAAAGCTTTGAATGGTGAAAGGAGTCGTTTGGCTCAAAGTTTTGAGTATAATTATGG
TGATTTTATTCCTATTTTGAGACCTTTTTTGAAAGGCTATTTGAAGGTTTGTAAAGAGGT
TAAAGATCGTAGGTTGCAGCTTTTCAAAGACTATTTTGTTGATGAAAGAAAGAAGCTTGA
AAGCACCAAGAGCACCACGAGCAATGATGGACTAAAATGTGCTATTGATCACATTTTGGA
TGCTCAAAAGAAGGGTGAAATCAATGATGACAACGTTCTTTACATTGTTGAGAACATCAA
TGTTGCTGCAATTGAAACAACACTATGGTCAATTGAATGGGGAATTGCTGAGCTAGTGAA
CCACCAAGACATCCAAAACAAAGTAAGGGAAGAAATGGACAGAGTTCTTGGACCAGGACA
CCAAGTAACTGAGCCAGATCTCCACAAGCTACCTTACCTACAAGCTGTGATCAAAGAGAC
ACTTCGTCTACGAATGGCGATCCCACTCCTCGTCCCACACATGAACCTTCATGATCCAAA
GCTCAATGGTTTTGATATCCCAGCCGAGAGCAAGATATTGGTCAATGCATGGTGGCTTCC
AAACAACCCGGCTCACTGGAAAAAGCCGGAGGAATTCAGGCCCGAACGGTTCTTGGAGGA
AGAGTCTCATGTTGAAGCTAATGGAAATGATTTTAGGTACCTTCCTTTCGGTGTTGGTAG
AAGAAGTTGCCCCGGAATCATTCTTGCCTTACCTATCCTTGGTATCACTATTGGGCGTCT
GGTTCAGAATGTCGAGCTTTTACCTCCACCCGGACAATCAAAGATTGACACTTCTGAGAA
AGGAGGACAGTTTAGTCTGCATATACTCAAACATTCAACCATTGTTGCTAAGCCAAGATC
ATTTTAATTAGTCTTCACACTAATACCCTTTTAATTTGTTTTACTTTACTTCGTGTAATG
CATTTTAATAATTCGAAATGTGGGAATGTTATTAAAATGTCTTATTAGCCTGCAATTGGG
TAGGTGAATAATGTTGTTGTTTTGTGCTTGTCCCATGTATAAACCTTTGAACTTGAAGTA
ATGGTTTTGAGATGATTTTGT
EST members of Unigene CO515318  CO514181  CO513037  EX521724  ALFEICA4HA 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase);
Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1;
Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1;
Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1
EC 1.14.14.1  1.14.99.9 
Transcription Factor Family
Transporter Classification Family
Probeset Msa.2979.1.S1_at, Mtr.45885.1.S1_at
Corresponding NCBI Gene 817599 
Trichome-related Gene from Literature 817599