Detail of EST/Unigene TCMS40532
Acc. TCMS40532
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Antirrhinum majus E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Dianthus caryophyllus E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic OS=Sinapis alba E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic (Fragment) OS=Nicotiana tabacum E-value=0; Glyceraldehyde-3-phosphate dehydrogenase, cytosolic 3 OS=Zea mays E-value=0;
Length 1305 nt
Species Medicago sativa
Belonged EST Libraries MS_TRI2 (2 ESTs); MS_CDS (1 ESTs); MS_TRI1 (1 ESTs);
Sequence ATCTGACAAGAAGATCAGGATCGGAATCAACGGATTTGGAAGAATTGGACGATTGGTTGC
TAGAGTTGCTCTTCAAAGAAACGATGTTGAACTCGTTGCTATCAACGATCCTTTCATCAC
TACTGATTACATGACCTATATGTTCAAGTATGACACTGTTCACGGTCAGTGGAAGCATTT
TGAACTTAAGGTTAAGGACACTAAGACCCTTCTCTTTGGTGAGAAAGAAGTTGCTGTTTT
CGGAACCAGGAACCCTGAGGAGATTCCATGGGGTGAGGTTGGAGCTGATTACGTTATTGA
GTCAACTGGTGTTTCCACTGACAAGGACAAAGCTGCTGCTCACTTGAAGGGTGGTGCCAA
GAAGGTTGTTATTTCTGCTCCCAGCAAAGATGCACCTATGTTTGTTGTTGGTGTTAACGA
GAAGGAATACAAACCAGAGCTTAACATTGTTTCCAATGCTAGTTGCACTACTAACTGCCT
TGCTCCCCTCGCCAAGGTTATTAATGACCGATTTGGAATCGTTGAGGGTCTTATGACCAC
AGTTCACGCCATCACAGCCACTCAGAAGACTGTTGATGGTCCATCAAGCAAGGACTGGAG
AGGTGGAAGAGCTGCTTCCTTCAACATCATTCCCAGCAGCACTGGAGCTGCCAAGGCTGT
AGGCAAAGTGCTTCCAGTATTGAACGGTAAATTGACCGGAATGTCATTCCGTGTCCCAAC
CGTCGATGTTTCAGTTGTTGACCTTACTGTAAGGCTTGAGAAGAAAGCAACCTACGAGCA
GATCAAGGCTGCCATCAAGGAGGAATCAGAGGGCAAGCTGAAGGGTATTTTGGGTTACAC
TGAAGATGATGTGGTATCTACTGACTTTATTGGCGATAGCAGGTCTAGCATCTTTGATGC
CAAAGCTGGAATTGCTTTGAATGACAACTTTGTGAAACTCGTTTCTTGGTATGACAACGA
ATGGGGTTACAGTACCCGTGTTATTGATTTGATTGTCCACATTGCTTCTGTGGCTTGATG
AGTCTGAGCTTGGATTGCATTGGAGTGTTCCAAATTTTGTCTCACTGGAGATTGTCATAG
TGTGAATTTCAACCAAGAATAAAAATTTGTGTTGCTGGGAGTGATCTCGCTGATACACAT
TTTCTGCATTTTTATTTTTGTATTTTGGATTGAATAGACGGCTTTAGGTTTTTACCTACT
CTTGTTTTAGAGAGGGATCTTTTCATTTTGATAATCATCTTACAATATTTACCATGTCTC
TTTGCGATCCTCTTTATATTTAGCTTGATTGAGCTTTGCTTATCG
EST members of Unigene CO515967  EX524632  EX523091  EF526095 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00134 glyceraldehyde 3-phosphate dehydrogenase
EC 1.2.1.12 
Transcription Factor Family
Transporter Classification Family
Probeset AFFX-Mtr-gapc-5_at, AFFX-Mtr-gapc-M_at
Corresponding NCBI Gene 837904 
Trichome-related Gene from Literature N/A