Detail of EST/Unigene TCHL61966
Acc. TCHL61966
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 688 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170 (3 ESTs); SRR546168 (2 ESTs); SRR546172 (1 ESTs); SRR546165 (1 ESTs);
Sequence GCACATCACTCTAGAAGAATTAAAATTTTGAAGAACCAACTTTAATTATGGTGCTTCTCA
AAATCATTTCTAAATAGAAACTGAATATACTGGTTAATCCATAATAATAATCTAACTAGA
ATCAGGTCTAACAAACACTACCTTTTCCTTTTTATTTATCCCATGAAAAATGGAAGGAGC
TGAAGACAATGATTGCAGTGCAGCCCTACTCACCACCCAATTTACAATTTTCCTCTCACC
CAAATCCCCTGAAAAATGGCTCAAATGTAAACTAAATACAGAAGAATATGCAATAAAAGA
AAATAGGAAATAAACTGTATCCCCCAAGGCCTTCCAAATTGGTATCTCCTCTCTTTATCT
TTTGAATCTGCTCTCTATTTTCTTTGGCTTTCCACACTCACCAAACAATGAAAATCCTCC
TCCGCTCTTGTGGGGTGGCCGAACGGGGGCTCCTCTTACCTTTCCCTTACTTTGGGGTTT
TCGATTATTCCAACAGAAAAATCTGCTGCACCCTCTTGTTCCAGACCCTGATTCATAACC
CAGGTTCTCTTTCATAGAATTGCCCAAGATGCTCGTATCATGCAATAAACTTGGGGACAT
AGGGCAACGATCCACCCTTCTACATGTCTGCTCTTTTTGAAGGACCTTTCCATTGTTAAC
CTTCAAAAGCTTTGAGTTCATGGTTTAG
EST members of Unigene SRR546172.82042  SRR546165.67470  SRR546170.65509  SRR546170.125786  SRR546168.136239  SRR546168.53325  SRR546170.57358 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 814777 
Trichome-related Gene from Literature 814777