Detail of EST/Unigene TCHL60709
Acc. TCHL60709
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Tubulin-specific chaperone A OS=Arabidopsis thaliana E-value=3e-33; Tubulin-specific chaperone A OS=Gallus gallus E-value=5e-11; Tubulin-specific chaperone A OS=Homo sapiens E-value=2e-10; Tubulin-specific chaperone A OS=Rattus norvegicus E-value=9e-10; Tubulin-specific chaperone A OS=Oryctolagus cuniculus E-value=1e-09;
Length 802 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170 (36 ESTs); SRR546165 (36 ESTs); SRR546168 (16 ESTs); SRR546172 (11 ESTs); HLUPJN1 (1 ESTs);
Sequence AGATTTTCACTTCTCACTTCACACACTCCCTTCCTCTTTAATCAGTCAAGCCTCACGCCC
AACCACCCAGAGAAGCGGCTGAGAGAGACTGCGGGCACGAAGCTTCAAGTCGCCTCCACT
GGCTGCTCTCTACTCCACTTTGCCGAAGCTTCATCAGTTCTTTACTCCGCCGAAGCATAG
AGGATCAGAATAAGAACTCAGAAATTTGATATTATATTGGGATGGCAACCCTAAGAAGTC
TGAAGATCAAAACAAGTACTTGTAAACGCCTAGAGAGAGAGCTTCATTCGTATGAGAAAG
AGGTCGAGACTGAGGCTGCCAAGACTGCCAAGATGAAGGAGAATGGAGCCGACCCTTATG
ATCTCAAGCAACAGGAAAATGTGTTGGCAGAATCAAGGATGATGATTCCTGATTGCAGAA
AGCGGCTGGAGTCATCCTTAGCTGACCTTAAAGCTACTTTGGCAGAGTTAGAAGAGTTGA
ATCAGAAGGAAGGCGCAGAAATTGAAGAGGCTCGGACCACTATCTCCCAAGTTGAGAGCT
TATTTCCAACAAGCTCAACTTCAGAATCTGAAATCTTGTGATTACATCACTTGCTGCGGA
TTTAGATATGGGTTTTGAATTGCCTTTTTTGTCTTTGGGTTGATTTGGATGAATCTTGTA
TTTCTAGACACTGCTTTATCCTCATTCCTATTTTTCTATTGGATTTGTTGTGCCTTCAAA
TTTGACATTTTGAACACTTCAGATTTGAGCTAATCTTCTTTAAGTGTTATCTGTATTGGG
CTTTCTATCTTGGAATTAATTT
EST members of Unigene SRR546165.246564  SRR546168.53326  SRR546170.154943  SRR546170.78624  SRR546170.103936  SRR546170.16029  SRR546170.578  SRR546165.144153  SRR546172.104611  SRR546165.246191  SRR546168.65707  SRR546170.131169  SRR546170.20654  SRR546170.126338  SRR546165.221619  SRR546165.156105  SRR546168.54663  SRR546165.30115  SRR546170.162470  SRR546165.84226  SRR546165.12528  SRR546165.232450  SRR546165.133313  SRR546165.244433  SRR546165.224132  SRR546168.8325  SRR546168.32886  SRR546170.68040  SRR546172.155263  SRR546165.162161  SRR546165.321006  SRR546170.57034  SRR546165.83709  SRR546170.136243  SRR546172.131517  SRR546172.30262  SRR546168.21482  SRR546168.58775  SRR546165.129877  SRR546165.91984  SRR546170.14108  SRR546170.21455  SRR546170.51411  SRR546168.128322  SRR546165.301466  SRR546165.266503  SRR546165.67454  GD243405  SRR546170.64360  SRR546170.128527  SRR546165.318898  SRR546170.28094  SRR546170.41820  SRR546170.93785  SRR546165.263480  SRR546170.88773  SRR546165.113906  SRR546170.72938  SRR546168.56523  SRR546170.119305  SRR546168.3585  SRR546165.239507  SRR546165.124518  SRR546170.27898  SRR546172.5132  SRR546170.56281  SRR546170.32518  SRR546165.79861  SRR546172.66219  SRR546165.211852  SRR546170.84304  SRR546165.55716  SRR546165.125479  SRR546170.3360  SRR546168.77587  SRR546165.92526  SRR546168.22561  SRR546172.83876  SRR546165.296572  SRR546170.4012  SRR546168.26048  SRR546170.94240  SRR546170.39959  SRR546168.73588  SRR546170.162458  SRR546165.13094  SRR546172.55664  SRR546165.312793  SRR546170.67368  SRR546170.76226  SRR546172.54856  SRR546172.149925  SRR546170.62705  SRR546165.319541  SRR546170.138442  SRR546172.118644  SRR546165.35681  SRR546165.83602  SRR546168.11735  SRR546168.55401 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817592 
Trichome-related Gene from Literature 817592