Detail of EST/Unigene TCHL57135
Acc. TCHL57135
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) DELLA protein GAIP-B OS=Cucurbita maxima E-value=0; DELLA protein GAIP OS=Cucurbita maxima E-value=0; DELLA protein GAI1 OS=Vitis vinifera E-value=0; DELLA protein RGA2 OS=Brassica campestris E-value=0; DELLA protein RGA OS=Arabidopsis thaliana E-value=0;
Length 1116 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165 (15 ESTs); SRR546172 (9 ESTs); SRR546170 (8 ESTs); SRR546168 (8 ESTs);
Sequence TTTTTCTTTTTTTTAAACATCAATAAACATAGGCATTTTTTTTTCGATTCATGAAGAAAA
TTACAAAAAGATTTCATCCAACCCAAAAAAGAAAAGAAAAAAGAAAACTACCTAAAAAAT
TAACCTAAAAAAAATAAATAAACTACAAAAAAAAAAAAAAGGTAAAAACTATGGGTCTTG
TTTTGTGGGCCTTAGTCTCAGCAAGGCACCCAGCTCAGAATAGCACATTTCCTGTTAAAC
AAACAAAACCCCACCACCAGACCAGCGTGGGGCTAAGAAAAAAAACTGGAATCGGGTGAA
AACCCGGCCCGACTCGTTATCTGACTCAGTGAGCCACTCCGAGTCTTTGCCCGGCGAGTT
GCCAGGCGGAAGTGGCTATGAGCGGTCGAGTGTGCCAACCCAACATGAGGCACCCGTTGT
TCTCCTCGACTCGATAGCCATCGCCGCCGGCGAAGAGGGCTAACAACATACTGGCTTGTT
TGAACGCGTTGGATCCGAGATGGGCCGGGGCGAACCCGGACGATTCCATCCGAGTTCGCC
ACTGAGTCAGCGTTTCGTGGCGCTCGACTCGGTCGGGTCCTTCGCAGGCGACCACGTTGG
CTATCTGCTTTCCCAGGTAGACCTCTGACATGATTTTGTCTTGGTCGTTGACCGATCCCT
CTAGCGAGTCGAACAGGGTCGAGTAATAGTGAAGCGCCTCCGTGAACCGGTCGACGAATA
GCGGTCCGTTATGGTTAGCCTCTTGCTCGACAATGGTAACGATCTCCGGCTTCATTTGTT
TAACTACAGATAAAACCTTTTCTATGGCTCCCGGACGAGCGAGAAGCTTGTGAAGCTCAA
ACACTGAGTTGACCGCCACCGCCTCGACCTCGCTCGGCCTGAGTTCGAGCATGGACGCGT
CGAGATCGGCTAAACTGTTTGCCACGAACCCTCTGTACTCAAACTCGACGTGGATCGTTT
CCGCCAATTGGGCCAACTTCCAGCCCACTTCTTGGAGATGGTCGGAGTTGTCCGGCGCTG
GAGGACCGATTCCGGTGAGACGGAAGGCCGGTGGACCGCCGGGCCTTAGAGCCAGGGCCT
GCATCAAAGCCGGCCATTGCATCCCCTGATTCATGG
EST members of Unigene SRR546165.273397  SRR546165.302762  SRR546170.54829  SRR546165.275324  SRR546165.230674  SRR546165.158591  SRR546168.87863  SRR546172.21637  SRR546165.184894  SRR546172.34823  SRR546168.105474  SRR546172.127651  SRR546172.76406  SRR546172.114287  SRR546170.89072  SRR546172.86444  SRR546165.281352  SRR546172.91847  SRR546165.3048  SRR546165.315485  SRR546172.136995  SRR546168.70618  SRR546165.128776  SRR546165.272942  SRR546168.25977  SRR546172.18301  SRR546170.96674  SRR546165.146355  SRR546165.187297  SRR546170.102293  SRR546170.86260  SRR546165.319712  SRR546170.163957  SRR546168.64457  SRR546165.231605  SRR546170.4737  SRR546168.54788  SRR546170.87040  SRR546168.50149  SRR546168.55750 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family GRAS
Transporter Classification Family
Probeset
Corresponding NCBI Gene 814686 
Trichome-related Gene from Literature 814686