Detail of EST/Unigene TCHL54425
Acc. TCHL54425
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) WRKY transcription factor 44 OS=Arabidopsis thaliana E-value=9e-68; Probable WRKY transcription factor 3 OS=Arabidopsis thaliana E-value=2e-65; Probable WRKY transcription factor 33 OS=Arabidopsis thaliana E-value=6e-63; Probable WRKY transcription factor 4 OS=Arabidopsis thaliana E-value=5e-62; Probable WRKY transcription factor 2 OS=Arabidopsis thaliana E-value=7e-57;
Length 1538 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165 (28 ESTs); SRR546172 (14 ESTs); HL_TRI (6 ESTs); SRR546168 (3 ESTs); SRR546170 (3 ESTs); HLUTR3CH (1 ESTs); HLUPLC (1 ESTs);
Sequence TATATCAAATTTTCTCACTTGTTATTTCCAGTAAAAAATTCAAAGAAGAAGAAAAAAAAG
GTGGGAATTTACCAAAACAACTAATCAAATCATAGCTCAAATAAGACTTCACATCTGTTC
TTTATGCTTCATCAAAACTAGTTATAATTAATTACCACTAAAGATACTTATTTTTCTGTG
TTCATTAAGACAAATAATACAAGTATGAAAGTAGAACAGTTAAGTGGAGGTGCATTAGAT
ATACTTTCTTTTCTTAAAAAATATATATATTATTATATAATAAAAATTAAATTAAAAAAT
AATAAAACTATATGAGTTGGCTGGCTAAAGATGTGTTTCCAAAAAGTCAGTAGTCATGTG
GTGTGTCTTTAGGGGCCTTAGTGTGAATCTCAGAGGACACAAGATTTGGAGTAGTCTTGA
TTGGCATGTCATGGTTATGTTTTCCCTCGTATGTTGTGATGAATGATTTTGGATCGTCTG
ATGCTCTTTCCACATGCTTCCTCACATTGCATTTCACACTCGTGCATCTATAGTAGCTTC
TTGGATATGGATTGCCCTTTACAACTTTCTGCCCATATTTTCTCCAGCGAAAGCCATCCC
CTGAAATGTTCTCTAAATCATTTGAATTTTGCATAACTCGACCTTCTTGAGTGCCTTCTC
CTGCTGATGTTCCTGCTTCATGTGATTGATTCTCACCTTTCCTTCTTTTCTGTCTTGGTT
CATCATCTTCTGCCTCAGGTTCAACACTAAAAGAATCATAAGGTTGAGAAGCTTTTCCTT
GGCCAGAATGTGTTAATAATACTCCAACTTCCCCTTCACAACATTCATTTTTTTCATTAA
CTTGACTATGCCATAATTGGTGGTTGGCGTCTAGACTGGGGGCAGCATCAGCCAATGCTG
GTGTCACAGACGAGGAGTTTCGCTTCGCAGGCAAAGGCTTAGAATGGTTGTGTTCACCCT
TGTAGACAATTTCAGCAATCTGTCCATCCAAAGATCTCTCAACTTTCTTTTTCACTACGC
AATTCGGATGCGTACACTTATAGTAACTTCGCGGATACTCGCTCCCTTTCACTTGTTTTT
GTCCATATTTTCTCCAATTGTATCCATCATAAGAAGGCCTGTCACTATTTGCAATGGAAG
GTAGAGATTTTGGATCCTCCTCCTCTTGGTTTTGTGGCTGGGACGCAATCTTTGAGGGCA
CAACCGTTTGATTAGTTTCAGCTCTTACTGAAACACTAGGGTTTAGATATGAGCTATGCT
GTGATCTAAAACTCTCTTTCTCTTGCTGTGGATGTTGAGCTTGAGAATCAACCAATGAAT
GTGTTTGTTGGAAGCTGTTATTGAAGTTTCCCATGTTCGCCAAAAGCGAAACGGTTGTCT
TGGAAACAACTTTTGCCAATGGTTTGTACACCACAGTTATCCCCTGAAATGTTCTCTAAA
TCATTTGAATTTTGCATAACTCGACCTTCTTGAGTGCCTTCTCCTGCTGATGTTCCTGCT
TCATGTGATTGATTCTCACCTTTCCTTCTTTTCTGTCT
EST members of Unigene SRR546165.34581  SRR546172.12606  SRR546170.90019  ES658680  SRR546172.42564  SRR546165.246556  SRR546165.244236  SRR546165.135437  SRR546168.95045  SRR546165.24115  SRR546165.276691  GD248961  SRR546165.73776  SRR546168.122502  ES656386  SRR546165.275415  SRR546165.308064  SRR546172.144825  ES656054  ES656052  SRR546165.225346  SRR546172.114683  SRR546165.57789  SRR546165.296639  SRR546165.232483  EX519844  SRR546165.129663  SRR546172.103114  SRR546170.117912  SRR546172.76681  SRR546165.270446  SRR546165.273915  SRR546165.14178  SRR546172.170003  SRR546165.276803  SRR546172.159560  SRR546165.100166  SRR546172.89607  SRR546172.96177  SRR546165.223650  SRR546170.131436  SRR546165.279141  SRR546172.143743  GD245066  SRR546165.293292  SRR546172.12187  SRR546165.49415  SRR546165.253292  SRR546168.101779  SRR546172.25130  SRR546165.154147  SRR546165.286300  SRR546172.62215  ES658484  SRR546165.282833  SRR546165.154144 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family WRKY
Transporter Classification Family
Probeset
Corresponding NCBI Gene 818303 
Trichome-related Gene from Literature 818303