Detail of EST/Unigene TCHL54337
Acc. TCHL54337
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 11 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 1 OS=Arabidopsis thaliana E-value=0;
Length 1571 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165 (13 ESTs); SRR546172 (7 ESTs); SRR546168 (7 ESTs); HLUTR2CH (1 ESTs); HLUTR3CH (1 ESTs); HLUPJN1 (1 ESTs);
Sequence GTTGGCTTCTTTGGTGTCTTCGTTTTCACTTTGACTGTTTATTTAATGTCTCGTCCTCGC
TCCATTTACCTTGTCGATTTTGCTTGTTATCGCCCTAGTGATGATCATAAGGTGTCAAGG
GAAGAATTCATAGAAGTAGCAAGAAAATCAGGGAAATTTGAGGAAGAAAGCTTAATGTTC
CAACAGAAAATAGTAAACTCATCAGGGCTTGGTGATGAGACATACATCCCAAAATCAGTG
ATCATGTCAGGCCAGAACACAGCCACCATGAAAGAAGGTCGAGCCGAGGCATCAATGGTG
ATGTTTGGAGCCCTAGACGAGCTGTTCGAGAAGACCAAAGTGAGGCCTAAAGACATAGGT
GTACTCGTTGTCAACTGCAGCATATTCAACCCTACACCTTCTCTTTCGGCCATGATCATA
AACCATTACAAGATGAGAGGTAATATTCTAAGCTTCAATCTTGGTGGGATGGGGTGTAGT
GCAGGGATCATAGCTGTTGATTTGGCTCGAGATATGCTCAAAGCAAACCCTAATAACTAT
GCGGTGGTTGTGAGTACTGAGATGGTGGGATACAATTGGTACCCGGGCAATGATCGCTCC
ATGCTCATCCCTAATTGTTTCTTTCGCATGGGTTGCTCCGCTCTTCTACTTTCTAATCGT
CGTCGCGATTATCACCGTGCTAAATATCGCCTTGAGCACATTGTTAGGACTCATAAAGGC
GCTGATGATTCGAGCTTCGGGGCTATCTGCCAAGAAGAAGACGAAAAAAGACAAAAGGGT
TTAAAAATAAGCAAAAACCTAATGGAAGTAGGTGGTGATGCCATCAAAACCAACATCACA
ACTCTAGGCCCACTTGTTCTCCCACTCTCCGAACAACTCCTCTTCTTTGCTACCCTAGTC
TGGACCCACCTCTTCGGCGGCACCACCGCCACCGCCACCGCCACCACCTCCGGCGAAAAG
GGCAGCTCTAATCACCCCCAACCATCCCTTTCCCCGGCCACCACAAAGAAGCCGTACATC
CCAGACTACAAGCTCGCATTCGAGCACTTCTGCATTCATGCAGCTAGCAAGCACGTGCTC
GACGAGCTCCAAAAAAATCTAGGGCTGAGCAAGCTCCACGTGGAGGCATCTAGGATGACT
CTCCATAGATTTGGCAACACCTCGAGCAGCAGCATATGGTACGAACTGTCGTATCTCGAG
GCCATGGAGAAAGTCAAGAGAGGAGACCGTGTTTGGCAGTTGTCGTTTGGGTCAGGTTTC
AAGTGTAACAGCCTTGTTTGGAGGTCACTTCGTCGAGTTCGAAAGCCTTTGACGAATAAT
CCTTGGCTTGATTGCATTGCTAAGTATCCAATTAATGATCTTATTAACTAAGCAAAAATG
TTATAATGATGAGATCGTATCAACAAAGATGGTGATAATATATATATATATATATTATAT
TTTGTGTGCTTGGAATTTGAAGATATATATGTTATGACACTTTACATATATGTTATAGAT
GATTTGGATTATAATGTCATGAAATATTTTAGATTTATAGTTTGTTCTTGCTATATTTCT
TTTTCATTAAT
EST members of Unigene SRR546165.20616  SRR546165.98495  SRR546168.94631  SRR546165.173650  SRR546165.184474  SRR546165.237427  SRR546172.37515  SRR546172.57438  SRR546165.34376  GD248506  SRR546168.58955  SRR546172.123573  SRR546168.58779  SRR546172.26191  SRR546168.128237  SRR546172.137577  SRR546165.232139  SRR546168.78911  SRR546168.41820  SRR546172.51163  SRR546168.99210  GD243430  SRR546172.52714  SRR546165.259822  SRR546165.266218  SRR546165.316641  SRR546165.217893  SRR546165.57879  GD251834  SRR546165.208608 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 817165 
Trichome-related Gene from Literature 817165