Detail of EST/Unigene SRR546172.53473
Acc. SRR546172.53473
Internal Acc. G2HQ8GE01D3WH0
Type EST
Annotation (Top 5 hits in Uniprot_trembl) CHD3-type chromatin-remodeling factor PICKLE OS=Arabidopsis thaliana E-value=2e-06;
Length 274 nt
Species Humulus lupulus
Belonged EST Libraries SRR546172;
Sequence CGTTATTACGGCCGGGGAACCCAAGGTCACAAATATCCCAAACGTGCCATGTTCTCTGTC
TGCTGAGAATGATGCATCCATGGTTGATCAGTTACCTCAATTGGAAGCCATTGGTCCTGA
AGAAATAGCTGCTGCTGCTTGTGATGATAATTCAGATCGGCTGCAATTGCCTCAGCTTTA
TAATGAGATGTGCAAAATAGTTGAGGAAACCACCACTGAATCAGTTCAGGGATCTTTGGC
CAACCAACCAGCTAATCTAGAACTTGGAGAATAA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A