Detail of EST/Unigene SRR546172.167887
Acc. SRR546172.167887
Internal Acc. G2HQ8GE01C7N9F
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=6e-14; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=4e-13; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=6e-13; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=1e-12; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=7e-12;
Length 130 nt
Species Humulus lupulus
Belonged EST Libraries SRR546172;
Sequence CGGAGCACCAACCATAACAAGCTTTCCATGAGGTTTCAAAAGACCAATTAAAGGCAATAG
AGGATGAACAGCGGAAACCGTGTCAATAATACCATCCATGGTTCCTATAGCAGCCTGGAC
CTGTTCTGGT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A