Detail of EST/Unigene SRR546172.154443
Acc. SRR546172.154443
Internal Acc. G2HQ8GE01CX2VQ
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=1e-28; Mannitol dehydrogenase (Fragment) OS=Petroselinum crispum E-value=7e-28; Mannitol dehydrogenase OS=Apium graveolens E-value=1e-27; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=2e-27; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=8e-27;
Length 330 nt
Species Humulus lupulus
Belonged EST Libraries SRR546172;
Sequence AAACTAGCTTTTGTTTCAATGATTCGCACACATAATTGAGCATTGAGCACTGTATATTAT
AGAAATCGAAACAAATATATATAAATATTAATCATAAGAGCTAGTTGGCTTCATTGTGTT
TGCAATGTCGATCACAAATCGGTATCTGACATCTGCTTTTAAAAGGCGTTCCGTTGCTGT
GTTCACGTAATCAATAGGAATAACCTCAATATCAGCCGTTATGTTGTGCTTGGCTGCAAC
GTCAATCATTTCTTGTGTTTCTTTCATCCCTCCAATGGAACTTCCACCTACTATCTTTCT
TCCCAATATCAAAGAAAAAGCTGGCAGTTC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A