Detail of EST/Unigene SRR546172.148265
Acc. SRR546172.148265
Internal Acc. G2HQ8GE01BC8PX
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=1e-23; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=7e-23; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=1e-22; Probable mannitol dehydrogenase OS=Medicago sativa E-value=4e-20; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=9e-20;
Length 249 nt
Species Humulus lupulus
Belonged EST Libraries SRR546172;
Sequence ATAGCAGCCTGGACCTGTTCTTGGTCACGGCTGACCAAAAATGAGTCAGCACCAATGCGT
TCAATAGCTTCTTTCTTCTTGTTTGGGGAGGTACTAATGACTGTGACCTTAGCCCCGAGA
GCCTTGGCGAATTTCACAGCGACATGGCCTAGCCCACCTAGACCAACGATGCCCACATGA
AGACCAGGCTTATCGAGTTCAAAGTATTTCAAGGGACTGTAGACTGTAATCCCAGCGCAG
AGGAGAGGA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A