Detail of EST/Unigene SRR546172.107900
Acc. SRR546172.107900
Internal Acc. G2HQ8GE01AOE74
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=2e-39; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=1e-36; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=2e-36; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=3e-35; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=3e-33;
Length 386 nt
Species Humulus lupulus
Belonged EST Libraries SRR546172;
Sequence TCGGCACCAAGGTGTTCAATAGCTTCTTGCTTCTTGTTCGGAGAGGTACTGATGACTGTG
ACCTTAGTCCCAAGAGCCTTGGCAAATTTCACAGCGACATGGCCCAGCCCACCTAGACCA
ACGATCCCCACATGAAGACCAGGCTTATCGAGTCCATAGTATTTCAAGGGACTGTAGACT
GTAATCCCAGCGCAGAGGAGAGGAGCAGCAGCGTCAAGAGGTAGGCTATCGGGAATGCGA
ACGATGAAATGCTCGTCGGCCACCATGATATCGGAGTAGCCTCCGTAGGTGGTGGTTCCG
TCGTGGTATTTGGCGGCATATGTGAGGATCATCTTTGGGCAGTAATTCTCTAGATCATTA
GCACAACTATCGCATGAGCCACAGGA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A