Detail of EST/Unigene SRR546170.77115
Acc. SRR546170.77115
Internal Acc. G2HQ8GE01DXQCU_2
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable cinnamyl alcohol dehydrogenase 9 OS=Arabidopsis thaliana E-value=2e-14; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=6e-14; Probable mannitol dehydrogenase OS=Medicago sativa E-value=2e-13; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=3e-13; Mannitol dehydrogenase OS=Apium graveolens E-value=1e-12;
Length 261 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence ATTCCTCATTATTTGTAATCTTCTTTACATAGTCACTCAGTACTTGCTTTTTCTCAGAAA
GAAACCAAACAAACATACAATAGAAGAAGCTTGATCGAACTAAAATGGCCAAGTCCTACG
AAGAAGAGCACCCCAAGAAGGCTTTTGGTTGGGCTGCTAGAGATTCATCTGGAGTCCTCT
CTCCCTTCCATTTCTCAAGAAGAGAAAACGGAGAGAAAGATGTTACGTTTAAAGTGATGT
ACTGGTGGGATATGCCACTCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A