Detail of EST/Unigene SRR546170.62690
Acc. SRR546170.62690
Internal Acc. G2HQ8GE01B8QOY_2
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=1e-22; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=4e-22; Probable cinnamyl alcohol dehydrogenase 9 OS=Oryza sativa subsp. japonica E-value=8e-18; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=7e-13; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=8e-13;
Length 317 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence GTCCCTTGAAATACTATGGACTCGATAAGCCTGGTCTTCATGTGGGGATCGTTGGTCTAG
GTGGGCTGGGCCATGTCGCTGTGAAATTTGCCAAGGCTCTTGGGACTAAGGTCACAGTCA
TCAGTACCTCTCCGAACAAGAAGCAAGAAGCTATTGAACACCTTGGTGCCGACTCATTTT
TTGGTCAGCCGTGACCAAGAACAGGTCCAGGCTGCCAATGGAACCATGGATGGTATTATT
GACACAGTTTCTGCTGTTCATCCTCTATTGCCTTTAATTGGTCTTTTTGAAGCCTCATGG
AAAGCTCGTTATGGTTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A