Detail of EST/Unigene SRR546170.60656
Acc. SRR546170.60656
Internal Acc. G2HQ8GE01AJYU6
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Mannitol dehydrogenase OS=Apium graveolens E-value=4e-19; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=6e-19; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=8e-19; Mannitol dehydrogenase (Fragment) OS=Petroselinum crispum E-value=2e-18; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=4e-18;
Length 313 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence TCGAAATACCAAGAAAAGTTCCAAAAACCAAAATGACGGCACCTTACATAAACTAGCTTT
TGTTTCAATGATTCGCACACATAATTGAGCATTGAGCACTGTATATTATAGAAATCGAAA
CAAATATATATAAATATTAATCATAAGAGCTAGTTGGCTTCATTGTGTTTGCAATGTCGA
TCACAAATCGGTATCTGACATCTGCTTTTAAAAGGCGTTCCGTTGCTGTGTTCACGTAAT
CAATAGGAATAACCTCAATATCAGCTGTTATGTTGTGCTTGGCTGCAACGTCAATCATTT
CTTGTGTTTCTCT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A