Detail of EST/Unigene SRR546170.49657
Acc. SRR546170.49657
Internal Acc. G2HQ8GE01D5ZXC
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=2e-52; Mannitol dehydrogenase (Fragment) OS=Petroselinum crispum E-value=8e-48; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=3e-47; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=3e-46; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=8e-45;
Length 363 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence CGTGTTCACGTAATCAATAGGAATAACCTCAATATCAGCTGTTATGTTGTGCTTGGCTGC
AACGTCAATCATTTCTTGTGTTTCTTTCATCCCTCCAATGGAACTTCCACCTACTATCTT
TCTTCCCAATATCAAAGAAAAAGCTGGCAGTTCAAGTGGTTTCTCCGGAGCACCAACCAT
AACGAGCTTTCCATGAGGCTTCAAAAGACCAATTAAAGGCAATAGAGGATGAACAGCAGA
AACTGTGTCAATAATACCATCCATGGTTCCATTGGCAGCCTGGACCTGTTCTTGGTCACG
GCTGACCAAAAATGAGTCGGCACCAAGGTGTTCAATAGCTTCTTGCTTCTTGTTCGGAGA
GGT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A