Detail of EST/Unigene SRR546170.36789
Acc. SRR546170.36789
Internal Acc. G2HQ8GE01AS63A_1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=1e-23; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=8e-21; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=1e-20; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=2e-20; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=2e-20;
Length 247 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence TACCATCCATGGTTCCATTGGCAGCCTGGACCTGTTCTTGGTCACGGCTGACCAAAAATG
AGTCGGCACCAAGGTGTTCAATAGCTTCTTGCCTCTTGTTCGGAGAGGTACTGATGACTG
TGACCTTAGTCCCAAGAGCCTTGGCAAATTTCACAGCGACATGGCCCAGCCCACCTAGAC
CAACGATCCCCACATGAAGACCAGGCTTATCGAGTCCATAGTATTTCAAGGGACTGTAGA
CTGTAAT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A