Detail of EST/Unigene SRR546170.28888
Acc. SRR546170.28888
Internal Acc. G2HQ8GE01BHU3T
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=9e-50; Mannitol dehydrogenase (Fragment) OS=Petroselinum crispum E-value=7e-47; Cinnamyl alcohol dehydrogenase 7 OS=Arabidopsis thaliana E-value=7e-47; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=4e-46; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=5e-45;
Length 398 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence CAATGGAACCATGGATGGTATTATTGACACAGTTTCTGCTGTTCATCCTCTATTGCCTTT
AATTGGTCTTTTGAAGCCTCATGGAAAGCTCGTTATGGTTGGTGCTCCGGAGAAACCACT
TGAACTGCCAGCTTTTTCTTTGATATTGGGAAGAAAGATAGTAGGTGGAAGTTCCATTGG
AGGGATGAAAGAAACACAAGAAATGATTGACGTTGCAGCCAAGCACAACATAACAGCTGA
TATTGAGGTTATTCCTATTGATTACGTGAACACAGCAACGGAACGCCTTTTAAAAGCAGA
TGTCAGATACCGATTTGTGATCGACATTGCAAACACAATGAAGCCAACTAGCTCTTATGA
TTAATATTTATATATATTTGTTTCGATTTCTATAATAT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A