Detail of EST/Unigene SRR546170.27287
Acc. SRR546170.27287
Internal Acc. G2HQ8GE01DF05M
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Medicago sativa E-value=2e-27; Probable mannitol dehydrogenase 1 OS=Stylosanthes humilis E-value=4e-25; Probable cinnamyl alcohol dehydrogenase 3 OS=Oryza sativa subsp. japonica E-value=8e-24; Probable cinnamyl alcohol dehydrogenase 8D OS=Oryza sativa subsp. japonica E-value=2e-23; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=7e-23;
Length 341 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence GTCGGCCACCATGATATCGGAGTAGCCTCCGTAGGAGGTGGTTCCGTCGTGGTATTTGGC
GGCATATGTGAGGATCATCTTTGGGCAGTAATTCTCTAGATCATTAGCACAACTATCGCA
TGAGCCACAGGAGCCCACCATGCACCCCACGCCAACTTTGTCACCAACTTTGAATTTCTG
CACTTTGCTTCCACCTCTGTTACCATTCCAACTATCTCGTGCCCAGGCACGAGAGGATAT
GTGGAAACGCCCCATTCATTCTTGAGCATATGCAAGTCGGAGTGGCATATCCCACAGTAC
ATCACTTTAAACGTAACATCTTTCTCTCCGTTTTCTCTTCT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A